Incidental Mutation 'R8108:Vmn2r1'
ID 630716
Institutional Source Beutler Lab
Gene Symbol Vmn2r1
Ensembl Gene ENSMUSG00000027824
Gene Name vomeronasal 2, receptor 1
Synonyms EG56544, V2r83
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock # R8108 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 64081642-64105458 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 64103050 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 570 (C570S)
Ref Sequence ENSEMBL: ENSMUSP00000029406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029406]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029406
AA Change: C570S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029406
Gene: ENSMUSG00000027824
AA Change: C570S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 86 504 6e-92 PFAM
Pfam:NCD3G 546 599 2.4e-17 PFAM
Pfam:7tm_3 632 866 4.1e-48 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 T A 12: 84,017,361 H414Q probably benign Het
Actrt2 A T 4: 154,667,036 D214E probably benign Het
Ccdc7a T C 8: 128,980,153 T332A unknown Het
Chd9 C T 8: 90,933,224 H271Y unknown Het
Depdc5 T G 5: 32,945,049 D966E probably benign Het
Dolpp1 A G 2: 30,396,246 Y119C probably benign Het
Dscam G C 16: 96,643,879 D1537E probably benign Het
Dusp16 A G 6: 134,739,873 I157T probably benign Het
Dyrk2 T C 10: 118,859,829 D508G probably benign Het
Endov T C 11: 119,507,411 V334A probably benign Het
Ep400 A T 5: 110,687,883 V1956E unknown Het
Erich3 A T 3: 154,720,115 Y83F possibly damaging Het
Fbrsl1 T C 5: 110,378,379 probably null Het
Gm1110 T C 9: 26,920,661 I65V probably damaging Het
Gm28374 A G 19: 6,082,200 V19A Het
Gm436 A T 4: 144,670,669 N164K probably benign Het
Gpr107 C A 2: 31,184,869 H336Q probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grm1 C A 10: 10,720,132 R584L probably benign Het
Gse1 T C 8: 120,229,810 S347P unknown Het
Ier3ip1 T A 18: 76,940,525 I69K possibly damaging Het
Impact T G 18: 12,984,331 L154V probably benign Het
Katnb1 T C 8: 95,093,945 F141S possibly damaging Het
Kifap3 T A 1: 163,797,362 N162K probably damaging Het
Klhl5 A G 5: 65,148,587 probably null Het
Klre1 A G 6: 129,584,222 D182G probably benign Het
Krt42 T A 11: 100,266,957 Y227F probably benign Het
Lhcgr T A 17: 88,742,050 K683* probably null Het
Lrrc37a G A 11: 103,503,057 S514F probably benign Het
Lrrc9 G T 12: 72,454,059 L186F probably damaging Het
Metrn A G 17: 25,795,030 V274A probably benign Het
Mettl25 A T 10: 105,823,179 F414L possibly damaging Het
Mixl1 A G 1: 180,696,702 V104A probably damaging Het
Myo9b T A 8: 71,348,342 M1047K probably damaging Het
Nbea G A 3: 55,819,315 A2081V probably benign Het
Ndufs1 A T 1: 63,150,012 D551E possibly damaging Het
Nectin3 T C 16: 46,464,121 T67A possibly damaging Het
Nme8 C T 13: 19,650,960 V519I probably benign Het
Npat G T 9: 53,571,129 G1379V probably benign Het
Obscn T A 11: 59,061,634 T3870S probably benign Het
Olfr1000 T C 2: 85,608,749 R54G possibly damaging Het
Olfr1288 T C 2: 111,479,234 V150A possibly damaging Het
Olfr177 T C 16: 58,872,236 M305V probably benign Het
Olfr379-ps1 T A 11: 73,433,854 H124L unknown Het
Olfr871 T A 9: 20,212,451 M34K possibly damaging Het
Olfr910 A G 9: 38,539,410 N172D probably damaging Het
Parp8 A T 13: 116,867,073 Y769* probably null Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phldb1 T C 9: 44,711,161 E65G probably damaging Het
Ppif C T 14: 25,698,326 T157M probably damaging Het
Ppp3ca T A 3: 136,932,225 probably null Het
Proser1 T A 3: 53,472,088 probably null Het
Reg3d T A 6: 78,376,079 K174* probably null Het
Rubcn A T 16: 32,856,950 L55Q probably damaging Het
Sec14l3 T C 11: 4,066,198 L39P probably damaging Het
Ska3 A G 14: 57,826,102 I4T probably damaging Het
Slc30a10 A G 1: 185,464,154 I338V possibly damaging Het
Slc35g1 C G 19: 38,402,829 S186R probably damaging Het
Slc35g1 T A 19: 38,402,831 L187H probably damaging Het
Spata5 T C 3: 37,431,782 S218P probably benign Het
Tbc1d5 T C 17: 50,742,086 I659V probably benign Het
Tbl3 G T 17: 24,700,916 D751E probably benign Het
Tdrd3 T A 14: 87,486,266 D311E possibly damaging Het
Tenm4 T C 7: 96,854,728 F1335S probably benign Het
Tm2d1 A T 4: 98,375,023 C83S probably damaging Het
Tnfrsf22 A T 7: 143,638,373 V192D unknown Het
Trpm6 A G 19: 18,811,790 T575A probably damaging Het
Uri1 T C 7: 37,981,673 D102G possibly damaging Het
Vps13a C T 19: 16,640,787 V2906I probably damaging Het
Zfp472 T C 17: 32,978,003 Y351H possibly damaging Het
Zfp874a G T 13: 67,443,234 Y110* probably null Het
Zfp986 T A 4: 145,899,305 N178K probably benign Het
Other mutations in Vmn2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Vmn2r1 APN 3 64104968 nonsense probably null
IGL00335:Vmn2r1 APN 3 64105388 missense probably damaging 0.96
IGL01509:Vmn2r1 APN 3 64103045 missense probably benign 0.03
IGL01641:Vmn2r1 APN 3 64104503 missense probably benign 0.19
IGL01656:Vmn2r1 APN 3 64081853 missense probably damaging 0.96
IGL01927:Vmn2r1 APN 3 64081684 missense probably benign 0.01
IGL02093:Vmn2r1 APN 3 64104709 missense probably benign
IGL02146:Vmn2r1 APN 3 64104683 missense probably benign 0.39
IGL02186:Vmn2r1 APN 3 64081717 missense probably benign 0.01
IGL02320:Vmn2r1 APN 3 64081759 missense possibly damaging 0.61
IGL02423:Vmn2r1 APN 3 64090244 missense probably benign 0.00
IGL02709:Vmn2r1 APN 3 64104934 missense probably benign 0.24
R0034:Vmn2r1 UTSW 3 64090014 missense probably damaging 1.00
R0064:Vmn2r1 UTSW 3 64104788 missense possibly damaging 0.76
R0152:Vmn2r1 UTSW 3 64081819 missense possibly damaging 0.92
R0305:Vmn2r1 UTSW 3 64089666 missense probably damaging 1.00
R0314:Vmn2r1 UTSW 3 64086559 missense probably damaging 1.00
R0317:Vmn2r1 UTSW 3 64081819 missense possibly damaging 0.92
R0465:Vmn2r1 UTSW 3 64081759 missense possibly damaging 0.61
R1144:Vmn2r1 UTSW 3 64090120 missense probably damaging 1.00
R1163:Vmn2r1 UTSW 3 64086625 missense probably benign 0.03
R1448:Vmn2r1 UTSW 3 64101313 missense probably damaging 1.00
R1491:Vmn2r1 UTSW 3 64089613 missense probably damaging 1.00
R1543:Vmn2r1 UTSW 3 64089573 missense probably damaging 1.00
R1611:Vmn2r1 UTSW 3 64104537 nonsense probably null
R1676:Vmn2r1 UTSW 3 64090182 nonsense probably null
R1727:Vmn2r1 UTSW 3 64081742 missense probably benign
R1851:Vmn2r1 UTSW 3 64101505 missense probably benign 0.32
R3080:Vmn2r1 UTSW 3 64089784 missense probably damaging 1.00
R3790:Vmn2r1 UTSW 3 64086764 critical splice donor site probably null
R4111:Vmn2r1 UTSW 3 64089755 missense probably benign 0.23
R4689:Vmn2r1 UTSW 3 64104653 missense possibly damaging 0.94
R4747:Vmn2r1 UTSW 3 64081846 missense probably benign 0.00
R4970:Vmn2r1 UTSW 3 64090123 missense possibly damaging 0.81
R5033:Vmn2r1 UTSW 3 64105080 missense probably damaging 1.00
R5086:Vmn2r1 UTSW 3 64089997 missense probably benign 0.00
R5112:Vmn2r1 UTSW 3 64090123 missense possibly damaging 0.81
R5385:Vmn2r1 UTSW 3 64101398 missense possibly damaging 0.89
R5629:Vmn2r1 UTSW 3 64105117 missense possibly damaging 0.87
R5762:Vmn2r1 UTSW 3 64090053 missense probably benign 0.24
R5867:Vmn2r1 UTSW 3 64104569 missense probably benign
R5893:Vmn2r1 UTSW 3 64086553 missense probably damaging 1.00
R6037:Vmn2r1 UTSW 3 64081729 missense probably benign 0.00
R6037:Vmn2r1 UTSW 3 64081729 missense probably benign 0.00
R6290:Vmn2r1 UTSW 3 64105452 missense probably benign 0.02
R6443:Vmn2r1 UTSW 3 64104953 missense possibly damaging 0.78
R6464:Vmn2r1 UTSW 3 64101345 missense probably benign
R6826:Vmn2r1 UTSW 3 64105146 nonsense probably null
R6874:Vmn2r1 UTSW 3 64104955 missense probably damaging 1.00
R6882:Vmn2r1 UTSW 3 64090108 missense possibly damaging 0.64
R6983:Vmn2r1 UTSW 3 64081697 missense probably benign
R7010:Vmn2r1 UTSW 3 64104725 missense probably benign 0.19
R7144:Vmn2r1 UTSW 3 64089941 missense probably damaging 1.00
R7341:Vmn2r1 UTSW 3 64105456 makesense probably null
R7510:Vmn2r1 UTSW 3 64086501 missense probably damaging 1.00
R7557:Vmn2r1 UTSW 3 64090054 missense probably damaging 0.99
R7895:Vmn2r1 UTSW 3 64089709 missense possibly damaging 0.90
R8209:Vmn2r1 UTSW 3 64089778 missense possibly damaging 0.64
R8365:Vmn2r1 UTSW 3 64086613 missense possibly damaging 0.80
R8514:Vmn2r1 UTSW 3 64086521 missense probably benign 0.11
R8554:Vmn2r1 UTSW 3 64089913 missense probably damaging 0.98
R8980:Vmn2r1 UTSW 3 64103080 missense
R9140:Vmn2r1 UTSW 3 64090044 missense probably benign 0.05
R9239:Vmn2r1 UTSW 3 64104538 missense probably damaging 0.99
R9441:Vmn2r1 UTSW 3 64105253 missense probably damaging 1.00
X0065:Vmn2r1 UTSW 3 64090257 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGCTTAGACTCCTGGGCTG -3'
(R):5'- AGGTCTGGTCTTATATCAGAAGTG -3'

Sequencing Primer
(F):5'- GCTTAGACTCCTGGGCTGATATC -3'
(R):5'- TGGTCATACTGCACACA -3'
Posted On 2020-06-30