Mutagenetix > Incidental Mutations

Incidental Mutation 'R8108:Depdc5'

630722

Institutional Source

Beutler Lab

Gene Symbol

Depdc5

Ensembl Gene

ENSMUSG00000037426

Gene Name

DEP domain containing 5

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8108 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32863701-32994236 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 32945049 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 966 (D966E)

Ref Sequence

ENSEMBL: ENSMUSP00000113862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000124780] [ENSMUST00000130461]

Predicted Effect

probably benign
Transcript: ENSMUST00000049780
AA Change: D966E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426
AA Change: D966E

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-64	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000087897
AA Change: D975E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: D975E

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	2.3e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	826	836	N/A	INTRINSIC
low complexity region	994	1006	N/A	INTRINSIC
low complexity region	1159	1175	N/A	INTRINSIC
DEP	1184	1259	2.49e-15	SMART
low complexity region	1322	1335	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119705
AA Change: D966E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: D966E

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3e-117	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1150	1166	N/A	INTRINSIC
DEP	1175	1250	2.49e-15	SMART
low complexity region	1313	1326	N/A	INTRINSIC
low complexity region	1511	1525	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120902
AA Change: D966E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: D966E

Domain	Start	End	E-Value	Type
Pfam:DUF3608	100	382	3.7e-63	PFAM
low complexity region	491	508	N/A	INTRINSIC
low complexity region	656	667	N/A	INTRINSIC
low complexity region	690	699	N/A	INTRINSIC
low complexity region	817	827	N/A	INTRINSIC
low complexity region	985	997	N/A	INTRINSIC
low complexity region	1128	1144	N/A	INTRINSIC
DEP	1153	1228	2.49e-15	SMART
low complexity region	1291	1304	N/A	INTRINSIC
low complexity region	1489	1503	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124780
AA Change: D328E

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000120120
Gene: ENSMUSG00000037426
AA Change: D328E

Domain	Start	End	E-Value	Type
low complexity region	179	189	N/A	INTRINSIC
low complexity region	347	359	N/A	INTRINSIC
SCOP:d1fsha_	519	586	1e-13	SMART
Blast:DEP	537	589	2e-24	BLAST

Predicted Effect

SMART Domains

Protein: ENSMUSP00000118681
Gene: ENSMUSG00000037426
AA Change: D51E

Domain	Start	End	E-Value	Type
low complexity region	70	82	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121089
Gene: ENSMUSG00000037426
AA Change: D372E

Domain	Start	End	E-Value	Type
low complexity region	54	65	N/A	INTRINSIC
low complexity region	88	97	N/A	INTRINSIC
low complexity region	224	234	N/A	INTRINSIC
low complexity region	392	404	N/A	INTRINSIC
low complexity region	535	551	N/A	INTRINSIC
DEP	560	635	2.49e-15	SMART
low complexity region	698	711	N/A	INTRINSIC
low complexity region	896	910	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.0%
20x: 97.3%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot1	T	A	12: 84,017,361	H414Q	probably benign	Het
Actrt2	A	T	4: 154,667,036	D214E	probably benign	Het
Ccdc7a	T	C	8: 128,980,153	T332A	unknown	Het
Chd9	C	T	8: 90,933,224	H271Y	unknown	Het
Dolpp1	A	G	2: 30,396,246	Y119C	probably benign	Het
Dscam	G	C	16: 96,643,879	D1537E	probably benign	Het
Dusp16	A	G	6: 134,739,873	I157T	probably benign	Het
Dyrk2	T	C	10: 118,859,829	D508G	probably benign	Het
Endov	T	C	11: 119,507,411	V334A	probably benign	Het
Ep400	A	T	5: 110,687,883	V1956E	unknown	Het
Erich3	A	T	3: 154,720,115	Y83F	possibly damaging	Het
Fbrsl1	T	C	5: 110,378,379		probably null	Het
Gm1110	T	C	9: 26,920,661	I65V	probably damaging	Het
Gm28374	A	G	19: 6,082,200	V19A		Het
Gm436	A	T	4: 144,670,669	N164K	probably benign	Het
Gpr107	C	A	2: 31,184,869	H336Q	probably damaging	Het
Gpr137b	T	C	13: 13,359,406	Y355C	probably damaging	Het
Grm1	C	A	10: 10,720,132	R584L	probably benign	Het
Gse1	T	C	8: 120,229,810	S347P	unknown	Het
Ier3ip1	T	A	18: 76,940,525	I69K	possibly damaging	Het
Impact	T	G	18: 12,984,331	L154V	probably benign	Het
Katnb1	T	C	8: 95,093,945	F141S	possibly damaging	Het
Kifap3	T	A	1: 163,797,362	N162K	probably damaging	Het
Klhl5	A	G	5: 65,148,587		probably null	Het
Klre1	A	G	6: 129,584,222	D182G	probably benign	Het
Krt42	T	A	11: 100,266,957	Y227F	probably benign	Het
Lhcgr	T	A	17: 88,742,050	K683*	probably null	Het
Lrrc37a	G	A	11: 103,503,057	S514F	probably benign	Het
Lrrc9	G	T	12: 72,454,059	L186F	probably damaging	Het
Metrn	A	G	17: 25,795,030	V274A	probably benign	Het
Mettl25	A	T	10: 105,823,179	F414L	possibly damaging	Het
Mixl1	A	G	1: 180,696,702	V104A	probably damaging	Het
Myo9b	T	A	8: 71,348,342	M1047K	probably damaging	Het
Nbea	G	A	3: 55,819,315	A2081V	probably benign	Het
Ndufs1	A	T	1: 63,150,012	D551E	possibly damaging	Het
Nectin3	T	C	16: 46,464,121	T67A	possibly damaging	Het
Nme8	C	T	13: 19,650,960	V519I	probably benign	Het
Npat	G	T	9: 53,571,129	G1379V	probably benign	Het
Obscn	T	A	11: 59,061,634	T3870S	probably benign	Het
Olfr1000	T	C	2: 85,608,749	R54G	possibly damaging	Het
Olfr1288	T	C	2: 111,479,234	V150A	possibly damaging	Het
Olfr177	T	C	16: 58,872,236	M305V	probably benign	Het
Olfr379-ps1	T	A	11: 73,433,854	H124L	unknown	Het
Olfr871	T	A	9: 20,212,451	M34K	possibly damaging	Het
Olfr910	A	G	9: 38,539,410	N172D	probably damaging	Het
Parp8	A	T	13: 116,867,073	Y769*	probably null	Het
Pcnx	C	T	12: 81,918,819	R59*	probably null	Het
Pdzd2	G	A	15: 12,373,506	S2181L	probably benign	Het
Phldb1	T	C	9: 44,711,161	E65G	probably damaging	Het
Ppif	C	T	14: 25,698,326	T157M	probably damaging	Het
Ppp3ca	T	A	3: 136,932,225		probably null	Het
Proser1	T	A	3: 53,472,088		probably null	Het
Reg3d	T	A	6: 78,376,079	K174*	probably null	Het
Rubcn	A	T	16: 32,856,950	L55Q	probably damaging	Het
Sec14l3	T	C	11: 4,066,198	L39P	probably damaging	Het
Ska3	A	G	14: 57,826,102	I4T	probably damaging	Het
Slc30a10	A	G	1: 185,464,154	I338V	possibly damaging	Het
Slc35g1	C	G	19: 38,402,829	S186R	probably damaging	Het
Slc35g1	T	A	19: 38,402,831	L187H	probably damaging	Het
Spata5	T	C	3: 37,431,782	S218P	probably benign	Het
Tbc1d5	T	C	17: 50,742,086	I659V	probably benign	Het
Tbl3	G	T	17: 24,700,916	D751E	probably benign	Het
Tdrd3	T	A	14: 87,486,266	D311E	possibly damaging	Het
Tenm4	T	C	7: 96,854,728	F1335S	probably benign	Het
Tm2d1	A	T	4: 98,375,023	C83S	probably damaging	Het
Tnfrsf22	A	T	7: 143,638,373	V192D	unknown	Het
Trpm6	A	G	19: 18,811,790	T575A	probably damaging	Het
Uri1	T	C	7: 37,981,673	D102G	possibly damaging	Het
Vmn2r1	T	A	3: 64,103,050	C570S	probably damaging	Het
Vps13a	C	T	19: 16,640,787	V2906I	probably damaging	Het
Zfp472	T	C	17: 32,978,003	Y351H	possibly damaging	Het
Zfp874a	G	T	13: 67,443,234	Y110*	probably null	Het
Zfp986	T	A	4: 145,899,305	N178K	probably benign	Het

Other mutations in Depdc5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Depdc5	APN	5	32967814	splice site	probably null
IGL01019:Depdc5	APN	5	32893401	missense	probably damaging	0.96
IGL01067:Depdc5	APN	5	32899067	splice site	probably null
IGL01405:Depdc5	APN	5	32937689	missense	possibly damaging	0.90
IGL01577:Depdc5	APN	5	32955897	missense	possibly damaging	0.49
IGL01633:Depdc5	APN	5	32924200	missense	probably damaging	1.00
IGL01998:Depdc5	APN	5	32945151	splice site	probably benign
IGL02025:Depdc5	APN	5	32946632	critical splice acceptor site	probably null
IGL02167:Depdc5	APN	5	32903801	missense	probably damaging	1.00
IGL02537:Depdc5	APN	5	32967787	missense	probably damaging	1.00
IGL02812:Depdc5	APN	5	32893368	splice site	probably benign
IGL03001:Depdc5	APN	5	32945090	missense	possibly damaging	0.74
IGL03253:Depdc5	APN	5	32868813	unclassified	probably benign
IGL02988:Depdc5	UTSW	5	32956167	splice site	probably null
R0038:Depdc5	UTSW	5	32868853	missense	probably benign	0.01
R0038:Depdc5	UTSW	5	32868853	missense	probably benign	0.01
R0153:Depdc5	UTSW	5	32933937	splice site	probably benign
R0179:Depdc5	UTSW	5	32901574	unclassified	probably benign
R0212:Depdc5	UTSW	5	32912242	missense	probably benign	0.00
R0239:Depdc5	UTSW	5	32943240	missense	probably damaging	1.00
R0239:Depdc5	UTSW	5	32943240	missense	probably damaging	1.00
R0302:Depdc5	UTSW	5	32904546	critical splice donor site	probably benign
R0511:Depdc5	UTSW	5	32945028	nonsense	probably null
R0677:Depdc5	UTSW	5	32901470	missense	probably damaging	1.00
R0884:Depdc5	UTSW	5	32917978	missense	possibly damaging	0.94
R0973:Depdc5	UTSW	5	32986966	missense	possibly damaging	0.92
R1314:Depdc5	UTSW	5	32877074	missense	probably damaging	1.00
R1611:Depdc5	UTSW	5	32990953	missense	probably damaging	1.00
R1687:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R1748:Depdc5	UTSW	5	32917942	missense	probably benign	0.24
R1903:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R1956:Depdc5	UTSW	5	32903831	missense	probably damaging	1.00
R1997:Depdc5	UTSW	5	32901906	critical splice donor site	probably null
R2079:Depdc5	UTSW	5	32946674	missense	possibly damaging	0.75
R2131:Depdc5	UTSW	5	32990781	nonsense	probably null
R2291:Depdc5	UTSW	5	32979402	missense	probably damaging	1.00
R2422:Depdc5	UTSW	5	32991035	missense	probably damaging	1.00
R2851:Depdc5	UTSW	5	32924171	missense	probably damaging	0.96
R2852:Depdc5	UTSW	5	32924171	missense	probably damaging	0.96
R2937:Depdc5	UTSW	5	32901621	splice site	probably null
R2938:Depdc5	UTSW	5	32901621	splice site	probably null
R2974:Depdc5	UTSW	5	32934017	critical splice donor site	probably null
R3884:Depdc5	UTSW	5	32944077	missense	probably damaging	1.00
R3967:Depdc5	UTSW	5	32944115	nonsense	probably null
R4118:Depdc5	UTSW	5	32964635	missense	probably damaging	1.00
R4197:Depdc5	UTSW	5	32991203	missense	possibly damaging	0.93
R4407:Depdc5	UTSW	5	32904534	critical splice donor site	probably null
R4534:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R4535:Depdc5	UTSW	5	32910407	critical splice acceptor site	probably benign
R4538:Depdc5	UTSW	5	32983946	missense	probably damaging	1.00
R4613:Depdc5	UTSW	5	32975446	missense	probably damaging	1.00
R4736:Depdc5	UTSW	5	32975322	missense	probably benign
R4738:Depdc5	UTSW	5	32975322	missense	probably benign
R4765:Depdc5	UTSW	5	32937635	missense	probably damaging	1.00
R5021:Depdc5	UTSW	5	32979414	missense	probably damaging	1.00
R5259:Depdc5	UTSW	5	32938291	missense	probably damaging	1.00
R5261:Depdc5	UTSW	5	32938291	missense	probably damaging	1.00
R5541:Depdc5	UTSW	5	32864629	utr 5 prime	probably benign
R5594:Depdc5	UTSW	5	32901490	missense	possibly damaging	0.46
R5929:Depdc5	UTSW	5	32975506	nonsense	probably null
R6132:Depdc5	UTSW	5	32910467	missense	probably damaging	0.99
R6146:Depdc5	UTSW	5	32968731	missense	probably benign	0.01
R6336:Depdc5	UTSW	5	32964507	splice site	probably null
R6468:Depdc5	UTSW	5	32912231	missense	probably benign	0.02
R6911:Depdc5	UTSW	5	32924192	missense	probably damaging	1.00
R6969:Depdc5	UTSW	5	32983860	missense	probably damaging	1.00
R7002:Depdc5	UTSW	5	32877158	splice site	probably null
R7066:Depdc5	UTSW	5	32901848	missense	probably benign	0.08
R7231:Depdc5	UTSW	5	32901865	missense	possibly damaging	0.92
R7264:Depdc5	UTSW	5	32967745	missense	probably benign
R7302:Depdc5	UTSW	5	32979508	missense	probably damaging	1.00
R7386:Depdc5	UTSW	5	32927936	missense	probably benign
R7564:Depdc5	UTSW	5	32901510	missense	probably damaging	1.00
R7636:Depdc5	UTSW	5	32917983	missense	probably benign
R7795:Depdc5	UTSW	5	32944103	missense	probably damaging	1.00
R7845:Depdc5	UTSW	5	32903915	splice site	probably null
R8013:Depdc5	UTSW	5	32973842	missense	probably benign	0.01
R8037:Depdc5	UTSW	5	32959348	critical splice donor site	probably null
R8038:Depdc5	UTSW	5	32959348	critical splice donor site	probably null
R8065:Depdc5	UTSW	5	32895908	missense	possibly damaging	0.89
R8067:Depdc5	UTSW	5	32895908	missense	possibly damaging	0.89
R8112:Depdc5	UTSW	5	32968706	missense	possibly damaging	0.67
R8213:Depdc5	UTSW	5	32937637	missense	probably damaging	1.00
R8382:Depdc5	UTSW	5	32927898	missense	probably benign	0.00
R8680:Depdc5	UTSW	5	32944038	missense	possibly damaging	0.48
R8743:Depdc5	UTSW	5	32924243	missense	probably benign	0.10
R8754:Depdc5	UTSW	5	32979537	missense	probably benign	0.00
X0027:Depdc5	UTSW	5	32904292	missense	probably damaging	1.00
Z1176:Depdc5	UTSW	5	32943282	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- CTTGCACCAGCTTCAGAGAG -3'
(R):5'- GGGTAGTCATGGGATACATCAC -3'

Sequencing Primer
(F):5'- GAGCTCCCTGGAAGGACTCTTATTAC -3'
(R):5'- TAGTCATGGGATACATCACCTGGC -3'

Posted On

2020-06-30