Incidental Mutation 'R8108:Depdc5'
ID630722
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene NameDEP domain containing 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8108 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location32863701-32994236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 32945049 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 966 (D966E)
Ref Sequence ENSEMBL: ENSMUSP00000113862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000124780] [ENSMUST00000130461]
Predicted Effect probably benign
Transcript: ENSMUST00000049780
AA Change: D966E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426
AA Change: D966E

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-64 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087897
AA Change: D975E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: D975E

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119705
AA Change: D966E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: D966E

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120902
AA Change: D966E

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: D966E

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124780
AA Change: D328E

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000120120
Gene: ENSMUSG00000037426
AA Change: D328E

DomainStartEndE-ValueType
low complexity region 179 189 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
SCOP:d1fsha_ 519 586 1e-13 SMART
Blast:DEP 537 589 2e-24 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000118681
Gene: ENSMUSG00000037426
AA Change: D51E

DomainStartEndE-ValueType
low complexity region 70 82 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121089
Gene: ENSMUSG00000037426
AA Change: D372E

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
low complexity region 224 234 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 535 551 N/A INTRINSIC
DEP 560 635 2.49e-15 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 T A 12: 84,017,361 H414Q probably benign Het
Actrt2 A T 4: 154,667,036 D214E probably benign Het
Ccdc7a T C 8: 128,980,153 T332A unknown Het
Chd9 C T 8: 90,933,224 H271Y unknown Het
Dolpp1 A G 2: 30,396,246 Y119C probably benign Het
Dscam G C 16: 96,643,879 D1537E probably benign Het
Dusp16 A G 6: 134,739,873 I157T probably benign Het
Dyrk2 T C 10: 118,859,829 D508G probably benign Het
Endov T C 11: 119,507,411 V334A probably benign Het
Ep400 A T 5: 110,687,883 V1956E unknown Het
Erich3 A T 3: 154,720,115 Y83F possibly damaging Het
Fbrsl1 T C 5: 110,378,379 probably null Het
Gm1110 T C 9: 26,920,661 I65V probably damaging Het
Gm28374 A G 19: 6,082,200 V19A Het
Gm436 A T 4: 144,670,669 N164K probably benign Het
Gpr107 C A 2: 31,184,869 H336Q probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Grm1 C A 10: 10,720,132 R584L probably benign Het
Gse1 T C 8: 120,229,810 S347P unknown Het
Ier3ip1 T A 18: 76,940,525 I69K possibly damaging Het
Impact T G 18: 12,984,331 L154V probably benign Het
Katnb1 T C 8: 95,093,945 F141S possibly damaging Het
Kifap3 T A 1: 163,797,362 N162K probably damaging Het
Klhl5 A G 5: 65,148,587 probably null Het
Klre1 A G 6: 129,584,222 D182G probably benign Het
Krt42 T A 11: 100,266,957 Y227F probably benign Het
Lhcgr T A 17: 88,742,050 K683* probably null Het
Lrrc37a G A 11: 103,503,057 S514F probably benign Het
Lrrc9 G T 12: 72,454,059 L186F probably damaging Het
Metrn A G 17: 25,795,030 V274A probably benign Het
Mettl25 A T 10: 105,823,179 F414L possibly damaging Het
Mixl1 A G 1: 180,696,702 V104A probably damaging Het
Myo9b T A 8: 71,348,342 M1047K probably damaging Het
Nbea G A 3: 55,819,315 A2081V probably benign Het
Ndufs1 A T 1: 63,150,012 D551E possibly damaging Het
Nectin3 T C 16: 46,464,121 T67A possibly damaging Het
Nme8 C T 13: 19,650,960 V519I probably benign Het
Npat G T 9: 53,571,129 G1379V probably benign Het
Obscn T A 11: 59,061,634 T3870S probably benign Het
Olfr1000 T C 2: 85,608,749 R54G possibly damaging Het
Olfr1288 T C 2: 111,479,234 V150A possibly damaging Het
Olfr177 T C 16: 58,872,236 M305V probably benign Het
Olfr379-ps1 T A 11: 73,433,854 H124L unknown Het
Olfr871 T A 9: 20,212,451 M34K possibly damaging Het
Olfr910 A G 9: 38,539,410 N172D probably damaging Het
Parp8 A T 13: 116,867,073 Y769* probably null Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phldb1 T C 9: 44,711,161 E65G probably damaging Het
Ppif C T 14: 25,698,326 T157M probably damaging Het
Ppp3ca T A 3: 136,932,225 probably null Het
Proser1 T A 3: 53,472,088 probably null Het
Reg3d T A 6: 78,376,079 K174* probably null Het
Rubcn A T 16: 32,856,950 L55Q probably damaging Het
Sec14l3 T C 11: 4,066,198 L39P probably damaging Het
Ska3 A G 14: 57,826,102 I4T probably damaging Het
Slc30a10 A G 1: 185,464,154 I338V possibly damaging Het
Slc35g1 C G 19: 38,402,829 S186R probably damaging Het
Slc35g1 T A 19: 38,402,831 L187H probably damaging Het
Spata5 T C 3: 37,431,782 S218P probably benign Het
Tbc1d5 T C 17: 50,742,086 I659V probably benign Het
Tbl3 G T 17: 24,700,916 D751E probably benign Het
Tdrd3 T A 14: 87,486,266 D311E possibly damaging Het
Tenm4 T C 7: 96,854,728 F1335S probably benign Het
Tm2d1 A T 4: 98,375,023 C83S probably damaging Het
Tnfrsf22 A T 7: 143,638,373 V192D unknown Het
Trpm6 A G 19: 18,811,790 T575A probably damaging Het
Uri1 T C 7: 37,981,673 D102G possibly damaging Het
Vmn2r1 T A 3: 64,103,050 C570S probably damaging Het
Vps13a C T 19: 16,640,787 V2906I probably damaging Het
Zfp472 T C 17: 32,978,003 Y351H possibly damaging Het
Zfp874a G T 13: 67,443,234 Y110* probably null Het
Zfp986 T A 4: 145,899,305 N178K probably benign Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 32967814 splice site probably null
IGL01019:Depdc5 APN 5 32893401 missense probably damaging 0.96
IGL01067:Depdc5 APN 5 32899067 splice site probably null
IGL01405:Depdc5 APN 5 32937689 missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 32955897 missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 32924200 missense probably damaging 1.00
IGL01998:Depdc5 APN 5 32945151 splice site probably benign
IGL02025:Depdc5 APN 5 32946632 critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 32903801 missense probably damaging 1.00
IGL02537:Depdc5 APN 5 32967787 missense probably damaging 1.00
IGL02812:Depdc5 APN 5 32893368 splice site probably benign
IGL03001:Depdc5 APN 5 32945090 missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 32868813 unclassified probably benign
IGL02988:Depdc5 UTSW 5 32956167 splice site probably null
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0153:Depdc5 UTSW 5 32933937 splice site probably benign
R0179:Depdc5 UTSW 5 32901574 unclassified probably benign
R0212:Depdc5 UTSW 5 32912242 missense probably benign 0.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0302:Depdc5 UTSW 5 32904546 critical splice donor site probably benign
R0511:Depdc5 UTSW 5 32945028 nonsense probably null
R0677:Depdc5 UTSW 5 32901470 missense probably damaging 1.00
R0884:Depdc5 UTSW 5 32917978 missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 32986966 missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 32877074 missense probably damaging 1.00
R1611:Depdc5 UTSW 5 32990953 missense probably damaging 1.00
R1687:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 32917942 missense probably benign 0.24
R1903:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 32903831 missense probably damaging 1.00
R1997:Depdc5 UTSW 5 32901906 critical splice donor site probably null
R2079:Depdc5 UTSW 5 32946674 missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 32990781 nonsense probably null
R2291:Depdc5 UTSW 5 32979402 missense probably damaging 1.00
R2422:Depdc5 UTSW 5 32991035 missense probably damaging 1.00
R2851:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2852:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2937:Depdc5 UTSW 5 32901621 splice site probably null
R2938:Depdc5 UTSW 5 32901621 splice site probably null
R2974:Depdc5 UTSW 5 32934017 critical splice donor site probably null
R3884:Depdc5 UTSW 5 32944077 missense probably damaging 1.00
R3967:Depdc5 UTSW 5 32944115 nonsense probably null
R4118:Depdc5 UTSW 5 32964635 missense probably damaging 1.00
R4197:Depdc5 UTSW 5 32991203 missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 32904534 critical splice donor site probably null
R4534:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 32983946 missense probably damaging 1.00
R4613:Depdc5 UTSW 5 32975446 missense probably damaging 1.00
R4736:Depdc5 UTSW 5 32975322 missense probably benign
R4738:Depdc5 UTSW 5 32975322 missense probably benign
R4765:Depdc5 UTSW 5 32937635 missense probably damaging 1.00
R5021:Depdc5 UTSW 5 32979414 missense probably damaging 1.00
R5259:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5261:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5541:Depdc5 UTSW 5 32864629 utr 5 prime probably benign
R5594:Depdc5 UTSW 5 32901490 missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 32975506 nonsense probably null
R6132:Depdc5 UTSW 5 32910467 missense probably damaging 0.99
R6146:Depdc5 UTSW 5 32968731 missense probably benign 0.01
R6336:Depdc5 UTSW 5 32964507 splice site probably null
R6468:Depdc5 UTSW 5 32912231 missense probably benign 0.02
R6911:Depdc5 UTSW 5 32924192 missense probably damaging 1.00
R6969:Depdc5 UTSW 5 32983860 missense probably damaging 1.00
R7002:Depdc5 UTSW 5 32877158 splice site probably null
R7066:Depdc5 UTSW 5 32901848 missense probably benign 0.08
R7231:Depdc5 UTSW 5 32901865 missense possibly damaging 0.92
R7264:Depdc5 UTSW 5 32967745 missense probably benign
R7302:Depdc5 UTSW 5 32979508 missense probably damaging 1.00
R7386:Depdc5 UTSW 5 32927936 missense probably benign
R7564:Depdc5 UTSW 5 32901510 missense probably damaging 1.00
R7636:Depdc5 UTSW 5 32917983 missense probably benign
R7795:Depdc5 UTSW 5 32944103 missense probably damaging 1.00
R7845:Depdc5 UTSW 5 32903915 splice site probably null
R8013:Depdc5 UTSW 5 32973842 missense probably benign 0.01
R8037:Depdc5 UTSW 5 32959348 critical splice donor site probably null
R8038:Depdc5 UTSW 5 32959348 critical splice donor site probably null
R8065:Depdc5 UTSW 5 32895908 missense possibly damaging 0.89
R8067:Depdc5 UTSW 5 32895908 missense possibly damaging 0.89
R8112:Depdc5 UTSW 5 32968706 missense possibly damaging 0.67
R8213:Depdc5 UTSW 5 32937637 missense probably damaging 1.00
R8382:Depdc5 UTSW 5 32927898 missense probably benign 0.00
R8680:Depdc5 UTSW 5 32944038 missense possibly damaging 0.48
R8743:Depdc5 UTSW 5 32924243 missense probably benign 0.10
R8754:Depdc5 UTSW 5 32979537 missense probably benign 0.00
X0027:Depdc5 UTSW 5 32904292 missense probably damaging 1.00
Z1176:Depdc5 UTSW 5 32943282 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CTTGCACCAGCTTCAGAGAG -3'
(R):5'- GGGTAGTCATGGGATACATCAC -3'

Sequencing Primer
(F):5'- GAGCTCCCTGGAAGGACTCTTATTAC -3'
(R):5'- TAGTCATGGGATACATCACCTGGC -3'
Posted On2020-06-30