Incidental Mutation 'R8108:Klhl5'
ID 630723
Institutional Source Beutler Lab
Gene Symbol Klhl5
Ensembl Gene ENSMUSG00000054920
Gene Name kelch-like 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R8108 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 65107539-65168188 bp(+) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to G at 65148587 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000098752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101191] [ENSMUST00000204097] [ENSMUST00000204348]
AlphaFold Q6PFE1
Predicted Effect probably null
Transcript: ENSMUST00000101191
SMART Domains Protein: ENSMUSP00000098752
Gene: ENSMUSG00000054920

DomainStartEndE-ValueType
low complexity region 114 137 N/A INTRINSIC
BTB 173 270 1.5e-28 SMART
BACK 275 376 7.85e-36 SMART
Kelch 421 467 1.12e-11 SMART
Kelch 468 514 3.2e-16 SMART
Kelch 515 561 1.51e-12 SMART
Kelch 562 608 4.6e-17 SMART
Kelch 609 661 2.84e-8 SMART
Kelch 662 708 1.83e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000204097
SMART Domains Protein: ENSMUSP00000144976
Gene: ENSMUSG00000054920

DomainStartEndE-ValueType
BTB 33 130 1.5e-28 SMART
BACK 135 236 7.85e-36 SMART
Kelch 281 327 1.12e-11 SMART
Kelch 328 374 3.2e-16 SMART
Kelch 375 421 1.51e-12 SMART
Kelch 422 468 4.6e-17 SMART
Kelch 469 521 2.84e-8 SMART
Kelch 522 568 1.83e-11 SMART
Predicted Effect probably null
Transcript: ENSMUST00000204348
SMART Domains Protein: ENSMUSP00000144732
Gene: ENSMUSG00000054920

DomainStartEndE-ValueType
BTB 111 209 1.32e-15 SMART
BACK 214 315 7.85e-36 SMART
Kelch 360 406 1.12e-11 SMART
Kelch 407 453 3.2e-16 SMART
Kelch 454 500 1.51e-12 SMART
Kelch 501 547 4.6e-17 SMART
Kelch 548 600 2.84e-8 SMART
Kelch 601 647 1.83e-11 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 T A 12: 84,017,361 H414Q probably benign Het
Actrt2 A T 4: 154,667,036 D214E probably benign Het
Ccdc7a T C 8: 128,980,153 T332A unknown Het
Chd9 C T 8: 90,933,224 H271Y unknown Het
Depdc5 T G 5: 32,945,049 D966E probably benign Het
Dolpp1 A G 2: 30,396,246 Y119C probably benign Het
Dscam G C 16: 96,643,879 D1537E probably benign Het
Dusp16 A G 6: 134,739,873 I157T probably benign Het
Dyrk2 T C 10: 118,859,829 D508G probably benign Het
Endov T C 11: 119,507,411 V334A probably benign Het
Ep400 A T 5: 110,687,883 V1956E unknown Het
Erich3 A T 3: 154,720,115 Y83F possibly damaging Het
Fbrsl1 T C 5: 110,378,379 probably null Het
Gm1110 T C 9: 26,920,661 I65V probably damaging Het
Gm28374 A G 19: 6,082,200 V19A Het
Gm436 A T 4: 144,670,669 N164K probably benign Het
Gpr107 C A 2: 31,184,869 H336Q probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grm1 C A 10: 10,720,132 R584L probably benign Het
Gse1 T C 8: 120,229,810 S347P unknown Het
Ier3ip1 T A 18: 76,940,525 I69K possibly damaging Het
Impact T G 18: 12,984,331 L154V probably benign Het
Katnb1 T C 8: 95,093,945 F141S possibly damaging Het
Kifap3 T A 1: 163,797,362 N162K probably damaging Het
Klre1 A G 6: 129,584,222 D182G probably benign Het
Krt42 T A 11: 100,266,957 Y227F probably benign Het
Lhcgr T A 17: 88,742,050 K683* probably null Het
Lrrc37a G A 11: 103,503,057 S514F probably benign Het
Lrrc9 G T 12: 72,454,059 L186F probably damaging Het
Metrn A G 17: 25,795,030 V274A probably benign Het
Mettl25 A T 10: 105,823,179 F414L possibly damaging Het
Mixl1 A G 1: 180,696,702 V104A probably damaging Het
Myo9b T A 8: 71,348,342 M1047K probably damaging Het
Nbea G A 3: 55,819,315 A2081V probably benign Het
Ndufs1 A T 1: 63,150,012 D551E possibly damaging Het
Nectin3 T C 16: 46,464,121 T67A possibly damaging Het
Nme8 C T 13: 19,650,960 V519I probably benign Het
Npat G T 9: 53,571,129 G1379V probably benign Het
Obscn T A 11: 59,061,634 T3870S probably benign Het
Olfr1000 T C 2: 85,608,749 R54G possibly damaging Het
Olfr1288 T C 2: 111,479,234 V150A possibly damaging Het
Olfr177 T C 16: 58,872,236 M305V probably benign Het
Olfr379-ps1 T A 11: 73,433,854 H124L unknown Het
Olfr871 T A 9: 20,212,451 M34K possibly damaging Het
Olfr910 A G 9: 38,539,410 N172D probably damaging Het
Parp8 A T 13: 116,867,073 Y769* probably null Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phldb1 T C 9: 44,711,161 E65G probably damaging Het
Ppif C T 14: 25,698,326 T157M probably damaging Het
Ppp3ca T A 3: 136,932,225 probably null Het
Proser1 T A 3: 53,472,088 probably null Het
Reg3d T A 6: 78,376,079 K174* probably null Het
Rubcn A T 16: 32,856,950 L55Q probably damaging Het
Sec14l3 T C 11: 4,066,198 L39P probably damaging Het
Ska3 A G 14: 57,826,102 I4T probably damaging Het
Slc30a10 A G 1: 185,464,154 I338V possibly damaging Het
Slc35g1 C G 19: 38,402,829 S186R probably damaging Het
Slc35g1 T A 19: 38,402,831 L187H probably damaging Het
Spata5 T C 3: 37,431,782 S218P probably benign Het
Tbc1d5 T C 17: 50,742,086 I659V probably benign Het
Tbl3 G T 17: 24,700,916 D751E probably benign Het
Tdrd3 T A 14: 87,486,266 D311E possibly damaging Het
Tenm4 T C 7: 96,854,728 F1335S probably benign Het
Tm2d1 A T 4: 98,375,023 C83S probably damaging Het
Tnfrsf22 A T 7: 143,638,373 V192D unknown Het
Trpm6 A G 19: 18,811,790 T575A probably damaging Het
Uri1 T C 7: 37,981,673 D102G possibly damaging Het
Vmn2r1 T A 3: 64,103,050 C570S probably damaging Het
Vps13a C T 19: 16,640,787 V2906I probably damaging Het
Zfp472 T C 17: 32,978,003 Y351H possibly damaging Het
Zfp874a G T 13: 67,443,234 Y110* probably null Het
Zfp986 T A 4: 145,899,305 N178K probably benign Het
Other mutations in Klhl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Klhl5 APN 5 65148800 missense probably damaging 0.98
IGL02700:Klhl5 APN 5 65131430 nonsense probably null
R0064:Klhl5 UTSW 5 65141288 missense probably benign 0.13
R0142:Klhl5 UTSW 5 65143350 nonsense probably null
R0783:Klhl5 UTSW 5 65156253 splice site probably benign
R0828:Klhl5 UTSW 5 65162792 missense probably damaging 1.00
R1160:Klhl5 UTSW 5 65141340 missense probably benign 0.13
R1181:Klhl5 UTSW 5 65162885 missense probably damaging 0.99
R1611:Klhl5 UTSW 5 65164649 missense probably benign 0.00
R1903:Klhl5 UTSW 5 65166987 missense probably benign 0.37
R4880:Klhl5 UTSW 5 65158901 missense probably damaging 1.00
R4961:Klhl5 UTSW 5 65152690 intron probably benign
R5204:Klhl5 UTSW 5 65131438 missense possibly damaging 0.95
R5389:Klhl5 UTSW 5 65141282 missense possibly damaging 0.76
R5921:Klhl5 UTSW 5 65162956 missense probably damaging 0.96
R6769:Klhl5 UTSW 5 65164652 missense probably damaging 1.00
R6771:Klhl5 UTSW 5 65164652 missense probably damaging 1.00
R7008:Klhl5 UTSW 5 65143249 missense probably benign 0.02
R7214:Klhl5 UTSW 5 65131755 missense probably benign
R7227:Klhl5 UTSW 5 65141288 missense probably benign 0.00
R7239:Klhl5 UTSW 5 65161186 missense probably damaging 1.00
R7400:Klhl5 UTSW 5 65148590 missense possibly damaging 0.81
R7796:Klhl5 UTSW 5 65164622 missense probably damaging 1.00
R8081:Klhl5 UTSW 5 65162925 missense possibly damaging 0.94
R8185:Klhl5 UTSW 5 65156128 missense probably damaging 0.99
R8424:Klhl5 UTSW 5 65162962 missense probably benign 0.10
R8691:Klhl5 UTSW 5 65149538 intron probably benign
R8818:Klhl5 UTSW 5 65148646 missense probably benign 0.23
R9233:Klhl5 UTSW 5 65143330 missense possibly damaging 0.95
R9456:Klhl5 UTSW 5 65148596 missense probably damaging 1.00
X0009:Klhl5 UTSW 5 65162921 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCACAGTGTCGTCATCTGACAC -3'
(R):5'- AAAGTCTACTGAGATCCTTCCGC -3'

Sequencing Primer
(F):5'- AGTGTCGTCATCTGACACTGTTC -3'
(R):5'- ACTGAGATCCTTCCGCCTCTG -3'
Posted On 2020-06-30