Incidental Mutation 'R8108:Dusp16'
ID 630727
Institutional Source Beutler Lab
Gene Symbol Dusp16
Ensembl Gene ENSMUSG00000030203
Gene Name dual specificity phosphatase 16
Synonyms 3830417M17Rik, D6Ertd213e, MKP7, MKP-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.844) question?
Stock # R8108 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 134715468-134792625 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 134739873 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 157 (I157T)
Ref Sequence ENSEMBL: ENSMUSP00000098419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100857] [ENSMUST00000129433] [ENSMUST00000149776] [ENSMUST00000204083]
AlphaFold Q6PCP3
Predicted Effect probably benign
Transcript: ENSMUST00000100857
AA Change: I157T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098419
Gene: ENSMUSG00000030203
AA Change: I157T

DomainStartEndE-ValueType
RHOD 12 134 5.58e-16 SMART
DSPc 158 297 1.66e-68 SMART
Blast:DSPc 576 621 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000129433
AA Change: I157T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115925
Gene: ENSMUSG00000030203
AA Change: I157T

DomainStartEndE-ValueType
Blast:RHOD 1 67 8e-41 BLAST
PDB:2VSW|B 1 83 1e-52 PDB
DSPc 91 232 3.73e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148926
Predicted Effect probably benign
Transcript: ENSMUST00000149776
AA Change: I157T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144784
Gene: ENSMUSG00000030203
AA Change: I157T

DomainStartEndE-ValueType
RHOD 12 134 5.58e-16 SMART
Blast:DSPc 158 203 2e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000204083
SMART Domains Protein: ENSMUSP00000144834
Gene: ENSMUSG00000030203

DomainStartEndE-ValueType
RHOD 12 124 1.5e-8 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitogen-activated protein kinase phosphatase that is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. The encoded protein specifically regulates the c-Jun amino-terminal kinase (JNK) and extracellular signal-regulated kinase (ERK) pathways.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete neonatal lethality and decreased birth weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 T A 12: 84,017,361 H414Q probably benign Het
Actrt2 A T 4: 154,667,036 D214E probably benign Het
Ccdc7a T C 8: 128,980,153 T332A unknown Het
Chd9 C T 8: 90,933,224 H271Y unknown Het
Depdc5 T G 5: 32,945,049 D966E probably benign Het
Dolpp1 A G 2: 30,396,246 Y119C probably benign Het
Dscam G C 16: 96,643,879 D1537E probably benign Het
Dyrk2 T C 10: 118,859,829 D508G probably benign Het
Endov T C 11: 119,507,411 V334A probably benign Het
Ep400 A T 5: 110,687,883 V1956E unknown Het
Erich3 A T 3: 154,720,115 Y83F possibly damaging Het
Fbrsl1 T C 5: 110,378,379 probably null Het
Gm1110 T C 9: 26,920,661 I65V probably damaging Het
Gm28374 A G 19: 6,082,200 V19A Het
Gm436 A T 4: 144,670,669 N164K probably benign Het
Gpr107 C A 2: 31,184,869 H336Q probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grm1 C A 10: 10,720,132 R584L probably benign Het
Gse1 T C 8: 120,229,810 S347P unknown Het
Ier3ip1 T A 18: 76,940,525 I69K possibly damaging Het
Impact T G 18: 12,984,331 L154V probably benign Het
Katnb1 T C 8: 95,093,945 F141S possibly damaging Het
Kifap3 T A 1: 163,797,362 N162K probably damaging Het
Klhl5 A G 5: 65,148,587 probably null Het
Klre1 A G 6: 129,584,222 D182G probably benign Het
Krt42 T A 11: 100,266,957 Y227F probably benign Het
Lhcgr T A 17: 88,742,050 K683* probably null Het
Lrrc37a G A 11: 103,503,057 S514F probably benign Het
Lrrc9 G T 12: 72,454,059 L186F probably damaging Het
Metrn A G 17: 25,795,030 V274A probably benign Het
Mettl25 A T 10: 105,823,179 F414L possibly damaging Het
Mixl1 A G 1: 180,696,702 V104A probably damaging Het
Myo9b T A 8: 71,348,342 M1047K probably damaging Het
Nbea G A 3: 55,819,315 A2081V probably benign Het
Ndufs1 A T 1: 63,150,012 D551E possibly damaging Het
Nectin3 T C 16: 46,464,121 T67A possibly damaging Het
Nme8 C T 13: 19,650,960 V519I probably benign Het
Npat G T 9: 53,571,129 G1379V probably benign Het
Obscn T A 11: 59,061,634 T3870S probably benign Het
Olfr1000 T C 2: 85,608,749 R54G possibly damaging Het
Olfr1288 T C 2: 111,479,234 V150A possibly damaging Het
Olfr177 T C 16: 58,872,236 M305V probably benign Het
Olfr379-ps1 T A 11: 73,433,854 H124L unknown Het
Olfr871 T A 9: 20,212,451 M34K possibly damaging Het
Olfr910 A G 9: 38,539,410 N172D probably damaging Het
Parp8 A T 13: 116,867,073 Y769* probably null Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phldb1 T C 9: 44,711,161 E65G probably damaging Het
Ppif C T 14: 25,698,326 T157M probably damaging Het
Ppp3ca T A 3: 136,932,225 probably null Het
Proser1 T A 3: 53,472,088 probably null Het
Reg3d T A 6: 78,376,079 K174* probably null Het
Rubcn A T 16: 32,856,950 L55Q probably damaging Het
Sec14l3 T C 11: 4,066,198 L39P probably damaging Het
Ska3 A G 14: 57,826,102 I4T probably damaging Het
Slc30a10 A G 1: 185,464,154 I338V possibly damaging Het
Slc35g1 C G 19: 38,402,829 S186R probably damaging Het
Slc35g1 T A 19: 38,402,831 L187H probably damaging Het
Spata5 T C 3: 37,431,782 S218P probably benign Het
Tbc1d5 T C 17: 50,742,086 I659V probably benign Het
Tbl3 G T 17: 24,700,916 D751E probably benign Het
Tdrd3 T A 14: 87,486,266 D311E possibly damaging Het
Tenm4 T C 7: 96,854,728 F1335S probably benign Het
Tm2d1 A T 4: 98,375,023 C83S probably damaging Het
Tnfrsf22 A T 7: 143,638,373 V192D unknown Het
Trpm6 A G 19: 18,811,790 T575A probably damaging Het
Uri1 T C 7: 37,981,673 D102G possibly damaging Het
Vmn2r1 T A 3: 64,103,050 C570S probably damaging Het
Vps13a C T 19: 16,640,787 V2906I probably damaging Het
Zfp472 T C 17: 32,978,003 Y351H possibly damaging Het
Zfp874a G T 13: 67,443,234 Y110* probably null Het
Zfp986 T A 4: 145,899,305 N178K probably benign Het
Other mutations in Dusp16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Dusp16 APN 6 134725949 missense probably benign 0.13
IGL01305:Dusp16 APN 6 134718861 missense probably benign 0.03
IGL01331:Dusp16 APN 6 134718104 missense possibly damaging 0.53
IGL02535:Dusp16 APN 6 134718827 missense probably benign
IGL02606:Dusp16 APN 6 134761036 missense probably damaging 0.96
IGL02696:Dusp16 APN 6 134718435 missense probably damaging 0.99
ANU22:Dusp16 UTSW 6 134718861 missense probably benign 0.03
PIT4469001:Dusp16 UTSW 6 134761152 unclassified probably benign
PIT4504001:Dusp16 UTSW 6 134739883 missense possibly damaging 0.90
R0492:Dusp16 UTSW 6 134718402 missense probably benign
R0578:Dusp16 UTSW 6 134718321 missense probably damaging 1.00
R1630:Dusp16 UTSW 6 134720561 missense probably damaging 1.00
R1962:Dusp16 UTSW 6 134718136 nonsense probably null
R2004:Dusp16 UTSW 6 134718839 missense probably benign
R3690:Dusp16 UTSW 6 134761119 unclassified probably benign
R3730:Dusp16 UTSW 6 134718861 missense probably benign
R5778:Dusp16 UTSW 6 134718314 missense probably benign 0.01
R6267:Dusp16 UTSW 6 134720493 critical splice donor site probably null
R6296:Dusp16 UTSW 6 134720493 critical splice donor site probably null
R6860:Dusp16 UTSW 6 134725879 nonsense probably null
R7248:Dusp16 UTSW 6 134718977 missense probably benign 0.01
R7645:Dusp16 UTSW 6 134725925 missense probably damaging 0.97
R8743:Dusp16 UTSW 6 134717970 missense probably benign 0.35
R8824:Dusp16 UTSW 6 134739769 missense probably benign
R8934:Dusp16 UTSW 6 134741676 intron probably benign
R9328:Dusp16 UTSW 6 134739939 missense probably damaging 1.00
R9364:Dusp16 UTSW 6 134719019 missense probably damaging 1.00
R9430:Dusp16 UTSW 6 134760866 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACACTGACAATGTTTCCC -3'
(R):5'- GCTTGCATCTGTACCGTCTG -3'

Sequencing Primer
(F):5'- GACAATGTTTCCCCCTTTCTGG -3'
(R):5'- ATGGTTTTAGTCAAGTAGTTCCCAG -3'
Posted On 2020-06-30