Incidental Mutation 'R8108:Uri1'
ID 630728
Institutional Source Beutler Lab
Gene Symbol Uri1
Ensembl Gene ENSMUSG00000030421
Gene Name URI1, prefoldin-like chaperone
Synonyms NNX3, Rmp, C80913
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8108 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 37959992-38023551 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 37981673 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 102 (D102G)
Ref Sequence ENSEMBL: ENSMUSP00000145738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085513] [ENSMUST00000206581]
AlphaFold Q3TLD5
Predicted Effect probably damaging
Transcript: ENSMUST00000085513
AA Change: D100G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082646
Gene: ENSMUSG00000030421
AA Change: D100G

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:Prefoldin 35 150 3.3e-18 PFAM
Pfam:Prefoldin_3 43 141 5.2e-12 PFAM
low complexity region 207 226 N/A INTRINSIC
SCOP:d1qbkb_ 299 321 7e-3 SMART
low complexity region 358 368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206169
Predicted Effect probably damaging
Transcript: ENSMUST00000206327
AA Change: D94G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000206581
AA Change: D102G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes member of the prefoldin family of molecular chaperones. The encoded protein functions as a scaffolding protein and plays roles in ubiquitination and transcription, in part though interactions with the RNA polymerase II subunit RPB5. This gene may play a role in multiple malignancies including ovarian cancer and hepatocellular carcinoma. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 22. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 T A 12: 84,017,361 H414Q probably benign Het
Actrt2 A T 4: 154,667,036 D214E probably benign Het
Ccdc7a T C 8: 128,980,153 T332A unknown Het
Chd9 C T 8: 90,933,224 H271Y unknown Het
Depdc5 T G 5: 32,945,049 D966E probably benign Het
Dolpp1 A G 2: 30,396,246 Y119C probably benign Het
Dscam G C 16: 96,643,879 D1537E probably benign Het
Dusp16 A G 6: 134,739,873 I157T probably benign Het
Dyrk2 T C 10: 118,859,829 D508G probably benign Het
Endov T C 11: 119,507,411 V334A probably benign Het
Ep400 A T 5: 110,687,883 V1956E unknown Het
Erich3 A T 3: 154,720,115 Y83F possibly damaging Het
Fbrsl1 T C 5: 110,378,379 probably null Het
Gm1110 T C 9: 26,920,661 I65V probably damaging Het
Gm28374 A G 19: 6,082,200 V19A Het
Gm436 A T 4: 144,670,669 N164K probably benign Het
Gpr107 C A 2: 31,184,869 H336Q probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grm1 C A 10: 10,720,132 R584L probably benign Het
Gse1 T C 8: 120,229,810 S347P unknown Het
Ier3ip1 T A 18: 76,940,525 I69K possibly damaging Het
Impact T G 18: 12,984,331 L154V probably benign Het
Katnb1 T C 8: 95,093,945 F141S possibly damaging Het
Kifap3 T A 1: 163,797,362 N162K probably damaging Het
Klhl5 A G 5: 65,148,587 probably null Het
Klre1 A G 6: 129,584,222 D182G probably benign Het
Krt42 T A 11: 100,266,957 Y227F probably benign Het
Lhcgr T A 17: 88,742,050 K683* probably null Het
Lrrc37a G A 11: 103,503,057 S514F probably benign Het
Lrrc9 G T 12: 72,454,059 L186F probably damaging Het
Metrn A G 17: 25,795,030 V274A probably benign Het
Mettl25 A T 10: 105,823,179 F414L possibly damaging Het
Mixl1 A G 1: 180,696,702 V104A probably damaging Het
Myo9b T A 8: 71,348,342 M1047K probably damaging Het
Nbea G A 3: 55,819,315 A2081V probably benign Het
Ndufs1 A T 1: 63,150,012 D551E possibly damaging Het
Nectin3 T C 16: 46,464,121 T67A possibly damaging Het
Nme8 C T 13: 19,650,960 V519I probably benign Het
Npat G T 9: 53,571,129 G1379V probably benign Het
Obscn T A 11: 59,061,634 T3870S probably benign Het
Olfr1000 T C 2: 85,608,749 R54G possibly damaging Het
Olfr1288 T C 2: 111,479,234 V150A possibly damaging Het
Olfr177 T C 16: 58,872,236 M305V probably benign Het
Olfr379-ps1 T A 11: 73,433,854 H124L unknown Het
Olfr871 T A 9: 20,212,451 M34K possibly damaging Het
Olfr910 A G 9: 38,539,410 N172D probably damaging Het
Parp8 A T 13: 116,867,073 Y769* probably null Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phldb1 T C 9: 44,711,161 E65G probably damaging Het
Ppif C T 14: 25,698,326 T157M probably damaging Het
Ppp3ca T A 3: 136,932,225 probably null Het
Proser1 T A 3: 53,472,088 probably null Het
Reg3d T A 6: 78,376,079 K174* probably null Het
Rubcn A T 16: 32,856,950 L55Q probably damaging Het
Sec14l3 T C 11: 4,066,198 L39P probably damaging Het
Ska3 A G 14: 57,826,102 I4T probably damaging Het
Slc30a10 A G 1: 185,464,154 I338V possibly damaging Het
Slc35g1 C G 19: 38,402,829 S186R probably damaging Het
Slc35g1 T A 19: 38,402,831 L187H probably damaging Het
Spata5 T C 3: 37,431,782 S218P probably benign Het
Tbc1d5 T C 17: 50,742,086 I659V probably benign Het
Tbl3 G T 17: 24,700,916 D751E probably benign Het
Tdrd3 T A 14: 87,486,266 D311E possibly damaging Het
Tenm4 T C 7: 96,854,728 F1335S probably benign Het
Tm2d1 A T 4: 98,375,023 C83S probably damaging Het
Tnfrsf22 A T 7: 143,638,373 V192D unknown Het
Trpm6 A G 19: 18,811,790 T575A probably damaging Het
Vmn2r1 T A 3: 64,103,050 C570S probably damaging Het
Vps13a C T 19: 16,640,787 V2906I probably damaging Het
Zfp472 T C 17: 32,978,003 Y351H possibly damaging Het
Zfp874a G T 13: 67,443,234 Y110* probably null Het
Zfp986 T A 4: 145,899,305 N178K probably benign Het
Other mutations in Uri1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Uri1 APN 7 37961553 missense probably damaging 1.00
IGL00978:Uri1 APN 7 37996731 splice site probably benign
IGL01921:Uri1 APN 7 37981647 nonsense probably null
IGL02538:Uri1 APN 7 37965491 missense probably benign
IGL02750:Uri1 APN 7 37967481 nonsense probably null
R0677:Uri1 UTSW 7 37965500 missense probably benign 0.01
R0863:Uri1 UTSW 7 37969675 missense probably damaging 0.98
R0945:Uri1 UTSW 7 37969678 missense probably damaging 0.98
R1582:Uri1 UTSW 7 37965386 missense possibly damaging 0.93
R1700:Uri1 UTSW 7 37963524 missense probably damaging 1.00
R1793:Uri1 UTSW 7 37981691 missense probably damaging 1.00
R1839:Uri1 UTSW 7 37967389 missense probably benign 0.19
R1915:Uri1 UTSW 7 37961678 missense probably damaging 0.98
R3967:Uri1 UTSW 7 37965502 missense possibly damaging 0.85
R5609:Uri1 UTSW 7 37963529 nonsense probably null
R6022:Uri1 UTSW 7 37961477 utr 3 prime probably benign
R6395:Uri1 UTSW 7 37962549 missense probably benign 0.00
R6873:Uri1 UTSW 7 37965339 missense probably benign 0.00
R7602:Uri1 UTSW 7 37981628 missense probably benign 0.14
R8765:Uri1 UTSW 7 37996720 missense probably benign 0.18
R8788:Uri1 UTSW 7 37961578 missense
R9095:Uri1 UTSW 7 37963448 missense probably damaging 0.99
R9408:Uri1 UTSW 7 37969606 missense probably benign 0.28
Z1177:Uri1 UTSW 7 37981610 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACACAGCCTGGACTAGCAAG -3'
(R):5'- AACCAAAAGCTCCTGGTGAAATG -3'

Sequencing Primer
(F):5'- ACTAGCAAGTCCCGGCAGTTG -3'
(R):5'- GCTCCTGGTGAAATGTGAATAAAATG -3'
Posted On 2020-06-30