Incidental Mutation 'R8108:Myo9b'
ID 630731
Institutional Source Beutler Lab
Gene Symbol Myo9b
Ensembl Gene ENSMUSG00000004677
Gene Name myosin IXb
Synonyms
MMRRC Submission 067537-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.852) question?
Stock # R8108 (G1)
Quality Score 171.009
Status Validated
Chromosome 8
Chromosomal Location 71725358-71813357 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 71800986 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1047 (M1047K)
Ref Sequence ENSEMBL: ENSMUSP00000129220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071935] [ENSMUST00000168839] [ENSMUST00000170242] [ENSMUST00000212935]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000071935
AA Change: M1047K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071827
Gene: ENSMUSG00000004677
AA Change: M1047K

DomainStartEndE-ValueType
RA 15 114 3.7e-30 SMART
MYSc 140 954 N/A SMART
IQ 955 977 1.2e-3 SMART
IQ 978 1000 1.6e-5 SMART
IQ 1001 1022 4.3e-5 SMART
IQ 1023 1045 8.4e-5 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1232 1246 N/A INTRINSIC
Blast:MYSc 1247 1323 3e-19 BLAST
low complexity region 1348 1359 N/A INTRINSIC
coiled coil region 1563 1590 N/A INTRINSIC
C1 1591 1639 1.7e-14 SMART
RhoGAP 1668 1843 4.7e-71 SMART
coiled coil region 1901 1925 N/A INTRINSIC
low complexity region 1940 1952 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168839
AA Change: M1047K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131635
Gene: ENSMUSG00000004677
AA Change: M1047K

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1915 1939 N/A INTRINSIC
low complexity region 1954 1966 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170242
AA Change: M1047K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129220
Gene: ENSMUSG00000004677
AA Change: M1047K

DomainStartEndE-ValueType
RA 15 114 5.79e-28 SMART
MYSc 140 954 N/A SMART
IQ 955 977 2.46e-1 SMART
IQ 978 1000 3.35e-3 SMART
IQ 1001 1022 8.84e-3 SMART
IQ 1023 1045 1.77e-2 SMART
low complexity region 1050 1064 N/A INTRINSIC
low complexity region 1127 1145 N/A INTRINSIC
low complexity region 1211 1222 N/A INTRINSIC
low complexity region 1234 1257 N/A INTRINSIC
Blast:MYSc 1258 1334 3e-19 BLAST
low complexity region 1361 1372 N/A INTRINSIC
low complexity region 1581 1601 N/A INTRINSIC
C1 1605 1653 3.58e-12 SMART
RhoGAP 1682 1857 7.78e-69 SMART
coiled coil region 1931 1955 N/A INTRINSIC
low complexity region 1970 1982 N/A INTRINSIC
low complexity region 1992 2003 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212412
Predicted Effect probably damaging
Transcript: ENSMUST00000212935
AA Change: M1048K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin family of actin-based molecular motor heavy chain proteins. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-9 (MYH9). The protein has four IQ motifs located in the neck domain that bind calmodulin, which serves as a light chain. The protein complex has a single-headed structure and exhibits processive movement on actin filaments toward the minus-end. The protein also has rho-GTPase activity. Polymorphisms in this gene are associated with celiac disease and ulcerative colitis susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutants breed normal, but shows defect in macrophage motility and chemotaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 A T 4: 144,397,239 (GRCm39) N164K probably benign Het
Acot1 T A 12: 84,064,135 (GRCm39) H414Q probably benign Het
Actrt2 A T 4: 154,751,493 (GRCm39) D214E probably benign Het
Afg2a T C 3: 37,485,931 (GRCm39) S218P probably benign Het
Ccdc7a T C 8: 129,706,634 (GRCm39) T332A unknown Het
Chd9 C T 8: 91,659,852 (GRCm39) H271Y unknown Het
Depdc5 T G 5: 33,102,393 (GRCm39) D966E probably benign Het
Dolpp1 A G 2: 30,286,258 (GRCm39) Y119C probably benign Het
Dscam G C 16: 96,445,079 (GRCm39) D1537E probably benign Het
Dusp16 A G 6: 134,716,836 (GRCm39) I157T probably benign Het
Dyrk2 T C 10: 118,695,734 (GRCm39) D508G probably benign Het
Endov T C 11: 119,398,237 (GRCm39) V334A probably benign Het
Ep400 A T 5: 110,835,749 (GRCm39) V1956E unknown Het
Erich3 A T 3: 154,425,752 (GRCm39) Y83F possibly damaging Het
Fbrsl1 T C 5: 110,526,245 (GRCm39) probably null Het
Gm1110 T C 9: 26,831,957 (GRCm39) I65V probably damaging Het
Gm28374 A G 19: 6,132,230 (GRCm39) V19A Het
Gpr107 C A 2: 31,074,881 (GRCm39) H336Q probably damaging Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Grm1 C A 10: 10,595,876 (GRCm39) R584L probably benign Het
Gse1 T C 8: 120,956,549 (GRCm39) S347P unknown Het
Ier3ip1 T A 18: 77,028,221 (GRCm39) I69K possibly damaging Het
Impact T G 18: 13,117,388 (GRCm39) L154V probably benign Het
Katnb1 T C 8: 95,820,573 (GRCm39) F141S possibly damaging Het
Kifap3 T A 1: 163,624,931 (GRCm39) N162K probably damaging Het
Klhl5 A G 5: 65,305,930 (GRCm39) probably null Het
Klre1 A G 6: 129,561,185 (GRCm39) D182G probably benign Het
Krt42 T A 11: 100,157,783 (GRCm39) Y227F probably benign Het
Lhcgr T A 17: 89,049,478 (GRCm39) K683* probably null Het
Lrrc37a G A 11: 103,393,883 (GRCm39) S514F probably benign Het
Lrrc9 G T 12: 72,500,833 (GRCm39) L186F probably damaging Het
Metrn A G 17: 26,014,004 (GRCm39) V274A probably benign Het
Mettl25 A T 10: 105,659,040 (GRCm39) F414L possibly damaging Het
Mixl1 A G 1: 180,524,267 (GRCm39) V104A probably damaging Het
Nbea G A 3: 55,726,736 (GRCm39) A2081V probably benign Het
Ndufs1 A T 1: 63,189,171 (GRCm39) D551E possibly damaging Het
Nectin3 T C 16: 46,284,484 (GRCm39) T67A possibly damaging Het
Nme8 C T 13: 19,835,130 (GRCm39) V519I probably benign Het
Npat G T 9: 53,482,429 (GRCm39) G1379V probably benign Het
Obscn T A 11: 58,952,460 (GRCm39) T3870S probably benign Het
Or1e20-ps1 T A 11: 73,324,680 (GRCm39) H124L unknown Het
Or4g7 T C 2: 111,309,579 (GRCm39) V150A possibly damaging Het
Or5g23 T C 2: 85,439,093 (GRCm39) R54G possibly damaging Het
Or5k14 T C 16: 58,692,599 (GRCm39) M305V probably benign Het
Or7h8 T A 9: 20,123,747 (GRCm39) M34K possibly damaging Het
Or8b46 A G 9: 38,450,706 (GRCm39) N172D probably damaging Het
Parp8 A T 13: 117,003,609 (GRCm39) Y769* probably null Het
Pcnx1 C T 12: 81,965,593 (GRCm39) R59* probably null Het
Pdzd2 G A 15: 12,373,592 (GRCm39) S2181L probably benign Het
Phldb1 T C 9: 44,622,458 (GRCm39) E65G probably damaging Het
Ppif C T 14: 25,698,750 (GRCm39) T157M probably damaging Het
Ppp3ca T A 3: 136,637,986 (GRCm39) probably null Het
Proser1 T A 3: 53,379,509 (GRCm39) probably null Het
Reg3d T A 6: 78,353,062 (GRCm39) K174* probably null Het
Rubcn A T 16: 32,677,320 (GRCm39) L55Q probably damaging Het
Sec14l3 T C 11: 4,016,198 (GRCm39) L39P probably damaging Het
Ska3 A G 14: 58,063,559 (GRCm39) I4T probably damaging Het
Slc30a10 A G 1: 185,196,351 (GRCm39) I338V possibly damaging Het
Slc35g1 C G 19: 38,391,277 (GRCm39) S186R probably damaging Het
Slc35g1 T A 19: 38,391,279 (GRCm39) L187H probably damaging Het
Tbc1d5 T C 17: 51,049,114 (GRCm39) I659V probably benign Het
Tbl3 G T 17: 24,919,890 (GRCm39) D751E probably benign Het
Tdrd3 T A 14: 87,723,702 (GRCm39) D311E possibly damaging Het
Tenm4 T C 7: 96,503,935 (GRCm39) F1335S probably benign Het
Tm2d1 A T 4: 98,263,260 (GRCm39) C83S probably damaging Het
Tnfrsf22 A T 7: 143,192,110 (GRCm39) V192D unknown Het
Trpm6 A G 19: 18,789,154 (GRCm39) T575A probably damaging Het
Uri1 T C 7: 37,681,098 (GRCm39) D102G possibly damaging Het
Vmn2r1 T A 3: 64,010,471 (GRCm39) C570S probably damaging Het
Vps13a C T 19: 16,618,151 (GRCm39) V2906I probably damaging Het
Zfp472 T C 17: 33,196,977 (GRCm39) Y351H possibly damaging Het
Zfp874a G T 13: 67,591,353 (GRCm39) Y110* probably null Het
Zfp986 T A 4: 145,625,875 (GRCm39) N178K probably benign Het
Other mutations in Myo9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Myo9b APN 8 71,801,379 (GRCm39) missense probably benign
IGL01020:Myo9b APN 8 71,804,644 (GRCm39) missense probably benign
IGL01479:Myo9b APN 8 71,811,986 (GRCm39) missense probably damaging 1.00
IGL01704:Myo9b APN 8 71,812,286 (GRCm39) missense probably damaging 0.98
IGL01761:Myo9b APN 8 71,801,796 (GRCm39) missense probably damaging 0.96
IGL01766:Myo9b APN 8 71,743,161 (GRCm39) missense probably damaging 1.00
IGL01834:Myo9b APN 8 71,807,901 (GRCm39) missense possibly damaging 0.93
IGL01834:Myo9b APN 8 71,808,962 (GRCm39) missense probably damaging 1.00
IGL01838:Myo9b APN 8 71,787,034 (GRCm39) missense probably damaging 0.99
IGL02318:Myo9b APN 8 71,806,768 (GRCm39) missense probably damaging 0.98
IGL02333:Myo9b APN 8 71,811,637 (GRCm39) missense possibly damaging 0.65
IGL02340:Myo9b APN 8 71,743,689 (GRCm39) missense probably damaging 1.00
IGL02514:Myo9b APN 8 71,743,650 (GRCm39) missense probably damaging 1.00
IGL02593:Myo9b APN 8 71,743,417 (GRCm39) missense probably damaging 1.00
IGL03075:Myo9b APN 8 71,807,171 (GRCm39) missense probably damaging 1.00
IGL03332:Myo9b APN 8 71,801,418 (GRCm39) missense possibly damaging 0.78
avantgarde UTSW 8 71,796,806 (GRCm39) missense probably damaging 1.00
Freaky UTSW 8 71,743,463 (GRCm39) missense probably damaging 1.00
iconoclastic UTSW 8 71,743,119 (GRCm39) missense probably benign 0.37
unconventional UTSW 8 71,801,241 (GRCm39) missense probably benign 0.00
PIT4418001:Myo9b UTSW 8 71,775,591 (GRCm39) missense probably damaging 1.00
PIT4651001:Myo9b UTSW 8 71,795,456 (GRCm39) missense possibly damaging 0.83
R0023:Myo9b UTSW 8 71,786,412 (GRCm39) missense probably damaging 1.00
R0103:Myo9b UTSW 8 71,776,493 (GRCm39) splice site probably benign
R0103:Myo9b UTSW 8 71,776,493 (GRCm39) splice site probably benign
R0144:Myo9b UTSW 8 71,798,687 (GRCm39) missense probably damaging 1.00
R0207:Myo9b UTSW 8 71,807,869 (GRCm39) splice site probably benign
R0226:Myo9b UTSW 8 71,806,476 (GRCm39) missense probably damaging 1.00
R0227:Myo9b UTSW 8 71,796,806 (GRCm39) missense probably damaging 1.00
R0244:Myo9b UTSW 8 71,774,457 (GRCm39) missense probably damaging 1.00
R0277:Myo9b UTSW 8 71,808,596 (GRCm39) splice site probably benign
R0362:Myo9b UTSW 8 71,800,414 (GRCm39) missense probably damaging 1.00
R0689:Myo9b UTSW 8 71,783,400 (GRCm39) missense probably damaging 1.00
R0844:Myo9b UTSW 8 71,743,119 (GRCm39) missense probably benign 0.37
R1051:Myo9b UTSW 8 71,808,466 (GRCm39) missense probably damaging 1.00
R1469:Myo9b UTSW 8 71,743,680 (GRCm39) missense probably damaging 1.00
R1469:Myo9b UTSW 8 71,743,680 (GRCm39) missense probably damaging 1.00
R1526:Myo9b UTSW 8 71,808,408 (GRCm39) missense probably damaging 1.00
R1544:Myo9b UTSW 8 71,743,620 (GRCm39) missense probably damaging 1.00
R1565:Myo9b UTSW 8 71,767,836 (GRCm39) missense possibly damaging 0.46
R1645:Myo9b UTSW 8 71,775,622 (GRCm39) missense probably damaging 1.00
R1745:Myo9b UTSW 8 71,806,691 (GRCm39) missense probably damaging 1.00
R1820:Myo9b UTSW 8 71,786,002 (GRCm39) missense probably damaging 1.00
R2037:Myo9b UTSW 8 71,743,510 (GRCm39) missense probably damaging 1.00
R2050:Myo9b UTSW 8 71,743,194 (GRCm39) missense probably damaging 1.00
R2056:Myo9b UTSW 8 71,812,334 (GRCm39) missense possibly damaging 0.78
R2129:Myo9b UTSW 8 71,786,343 (GRCm39) missense probably damaging 1.00
R2423:Myo9b UTSW 8 71,780,584 (GRCm39) missense probably damaging 1.00
R2869:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2869:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2871:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2871:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2872:Myo9b UTSW 8 71,743,610 (GRCm39) missense probably benign 0.01
R2872:Myo9b UTSW 8 71,743,610 (GRCm39) missense probably benign 0.01
R2873:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2874:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2920:Myo9b UTSW 8 71,778,501 (GRCm39) missense probably damaging 0.98
R2926:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2939:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R2940:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3033:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3040:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3689:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3691:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R3735:Myo9b UTSW 8 71,801,241 (GRCm39) missense probably benign 0.00
R4194:Myo9b UTSW 8 71,812,268 (GRCm39) missense possibly damaging 0.71
R4258:Myo9b UTSW 8 71,808,409 (GRCm39) missense probably damaging 1.00
R4457:Myo9b UTSW 8 71,743,643 (GRCm39) missense probably damaging 1.00
R4478:Myo9b UTSW 8 71,743,725 (GRCm39) missense probably damaging 1.00
R4496:Myo9b UTSW 8 71,786,981 (GRCm39) missense probably benign 0.01
R4544:Myo9b UTSW 8 71,780,585 (GRCm39) missense probably damaging 1.00
R4580:Myo9b UTSW 8 71,767,779 (GRCm39) missense probably damaging 1.00
R4736:Myo9b UTSW 8 71,809,236 (GRCm39) missense probably damaging 1.00
R5068:Myo9b UTSW 8 71,801,699 (GRCm39) missense probably damaging 1.00
R5124:Myo9b UTSW 8 71,808,483 (GRCm39) missense probably damaging 1.00
R5194:Myo9b UTSW 8 71,801,733 (GRCm39) missense probably benign 0.01
R5296:Myo9b UTSW 8 71,786,032 (GRCm39) missense possibly damaging 0.69
R5528:Myo9b UTSW 8 71,775,918 (GRCm39) missense probably benign 0.06
R5664:Myo9b UTSW 8 71,812,526 (GRCm39) missense probably benign 0.13
R5677:Myo9b UTSW 8 71,796,330 (GRCm39) missense probably damaging 1.00
R5680:Myo9b UTSW 8 71,743,016 (GRCm39) missense probably benign 0.00
R5982:Myo9b UTSW 8 71,801,040 (GRCm39) missense probably benign 0.05
R6344:Myo9b UTSW 8 71,780,558 (GRCm39) missense probably damaging 1.00
R6352:Myo9b UTSW 8 71,801,055 (GRCm39) missense probably benign
R6352:Myo9b UTSW 8 71,801,054 (GRCm39) missense probably benign 0.16
R6411:Myo9b UTSW 8 71,775,599 (GRCm39) nonsense probably null
R6425:Myo9b UTSW 8 71,786,272 (GRCm39) missense probably damaging 1.00
R6505:Myo9b UTSW 8 71,808,501 (GRCm39) missense possibly damaging 0.88
R6743:Myo9b UTSW 8 71,804,803 (GRCm39) splice site probably null
R6811:Myo9b UTSW 8 71,809,222 (GRCm39) missense probably damaging 1.00
R6813:Myo9b UTSW 8 71,775,949 (GRCm39) missense probably damaging 1.00
R6954:Myo9b UTSW 8 71,743,463 (GRCm39) missense probably damaging 1.00
R7124:Myo9b UTSW 8 71,786,345 (GRCm39) nonsense probably null
R7255:Myo9b UTSW 8 71,743,535 (GRCm39) missense probably damaging 1.00
R7293:Myo9b UTSW 8 71,778,549 (GRCm39) missense probably benign 0.00
R7342:Myo9b UTSW 8 71,808,418 (GRCm39) missense probably damaging 1.00
R7451:Myo9b UTSW 8 71,804,832 (GRCm39) missense probably benign 0.28
R7482:Myo9b UTSW 8 71,795,442 (GRCm39) missense probably benign 0.00
R7508:Myo9b UTSW 8 71,807,445 (GRCm39) missense probably benign 0.00
R7957:Myo9b UTSW 8 71,807,405 (GRCm39) missense probably benign 0.12
R8062:Myo9b UTSW 8 71,774,457 (GRCm39) missense probably damaging 0.99
R8197:Myo9b UTSW 8 71,743,607 (GRCm39) missense probably damaging 1.00
R8274:Myo9b UTSW 8 71,812,480 (GRCm39) missense probably benign 0.00
R8686:Myo9b UTSW 8 71,786,966 (GRCm39) missense probably benign 0.01
R8731:Myo9b UTSW 8 71,806,486 (GRCm39) critical splice donor site probably null
R8924:Myo9b UTSW 8 71,801,675 (GRCm39) missense probably benign
R9056:Myo9b UTSW 8 71,804,906 (GRCm39) missense probably benign 0.17
R9117:Myo9b UTSW 8 71,800,451 (GRCm39) missense probably benign 0.03
R9151:Myo9b UTSW 8 71,807,871 (GRCm39) splice site probably benign
R9315:Myo9b UTSW 8 71,801,811 (GRCm39) missense possibly damaging 0.54
R9332:Myo9b UTSW 8 71,812,246 (GRCm39) missense probably benign 0.07
R9364:Myo9b UTSW 8 71,808,483 (GRCm39) missense probably damaging 1.00
R9569:Myo9b UTSW 8 71,811,629 (GRCm39) missense probably benign
R9581:Myo9b UTSW 8 71,812,543 (GRCm39) missense probably benign 0.19
R9600:Myo9b UTSW 8 71,743,075 (GRCm39) missense possibly damaging 0.80
X0066:Myo9b UTSW 8 71,776,542 (GRCm39) missense probably damaging 1.00
Z1177:Myo9b UTSW 8 71,743,353 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCCATCCTGAGCACCTAG -3'
(R):5'- CAGCTGGCACTGTCTTTTGG -3'

Sequencing Primer
(F):5'- ACCTAGCCTTGCAAGTTGG -3'
(R):5'- CTTAGGTGACATGCCGTCTG -3'
Posted On 2020-06-30