Incidental Mutation 'R8108:Ccdc7a'
ID 630735
Institutional Source Beutler Lab
Gene Symbol Ccdc7a
Ensembl Gene ENSMUSG00000025808
Gene Name coiled-coil domain containing 7A
Synonyms Ccdc7, 4930517G15Rik, 4930540C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R8108 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 128734235-129065517 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128980153 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 332 (T332A)
Ref Sequence ENSEMBL: ENSMUSP00000092780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095158] [ENSMUST00000125112] [ENSMUST00000214889]
AlphaFold Q9D541
Predicted Effect unknown
Transcript: ENSMUST00000095158
AA Change: T332A
SMART Domains Protein: ENSMUSP00000092780
Gene: ENSMUSG00000025808
AA Change: T332A

DomainStartEndE-ValueType
Pfam:BioT2 1 166 3e-79 PFAM
SCOP:d1sig__ 191 370 1e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000125112
AA Change: T332A
SMART Domains Protein: ENSMUSP00000117961
Gene: ENSMUSG00000025808
AA Change: T332A

DomainStartEndE-ValueType
Pfam:BioT2 1 166 4.3e-83 PFAM
SCOP:d1sig__ 191 333 9e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000214889
AA Change: T332A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 T A 12: 84,017,361 H414Q probably benign Het
Actrt2 A T 4: 154,667,036 D214E probably benign Het
Chd9 C T 8: 90,933,224 H271Y unknown Het
Depdc5 T G 5: 32,945,049 D966E probably benign Het
Dolpp1 A G 2: 30,396,246 Y119C probably benign Het
Dscam G C 16: 96,643,879 D1537E probably benign Het
Dusp16 A G 6: 134,739,873 I157T probably benign Het
Dyrk2 T C 10: 118,859,829 D508G probably benign Het
Endov T C 11: 119,507,411 V334A probably benign Het
Ep400 A T 5: 110,687,883 V1956E unknown Het
Erich3 A T 3: 154,720,115 Y83F possibly damaging Het
Fbrsl1 T C 5: 110,378,379 probably null Het
Gm1110 T C 9: 26,920,661 I65V probably damaging Het
Gm28374 A G 19: 6,082,200 V19A Het
Gm436 A T 4: 144,670,669 N164K probably benign Het
Gpr107 C A 2: 31,184,869 H336Q probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grm1 C A 10: 10,720,132 R584L probably benign Het
Gse1 T C 8: 120,229,810 S347P unknown Het
Ier3ip1 T A 18: 76,940,525 I69K possibly damaging Het
Impact T G 18: 12,984,331 L154V probably benign Het
Katnb1 T C 8: 95,093,945 F141S possibly damaging Het
Kifap3 T A 1: 163,797,362 N162K probably damaging Het
Klhl5 A G 5: 65,148,587 probably null Het
Klre1 A G 6: 129,584,222 D182G probably benign Het
Krt42 T A 11: 100,266,957 Y227F probably benign Het
Lhcgr T A 17: 88,742,050 K683* probably null Het
Lrrc37a G A 11: 103,503,057 S514F probably benign Het
Lrrc9 G T 12: 72,454,059 L186F probably damaging Het
Metrn A G 17: 25,795,030 V274A probably benign Het
Mettl25 A T 10: 105,823,179 F414L possibly damaging Het
Mixl1 A G 1: 180,696,702 V104A probably damaging Het
Myo9b T A 8: 71,348,342 M1047K probably damaging Het
Nbea G A 3: 55,819,315 A2081V probably benign Het
Ndufs1 A T 1: 63,150,012 D551E possibly damaging Het
Nectin3 T C 16: 46,464,121 T67A possibly damaging Het
Nme8 C T 13: 19,650,960 V519I probably benign Het
Npat G T 9: 53,571,129 G1379V probably benign Het
Obscn T A 11: 59,061,634 T3870S probably benign Het
Olfr1000 T C 2: 85,608,749 R54G possibly damaging Het
Olfr1288 T C 2: 111,479,234 V150A possibly damaging Het
Olfr177 T C 16: 58,872,236 M305V probably benign Het
Olfr379-ps1 T A 11: 73,433,854 H124L unknown Het
Olfr871 T A 9: 20,212,451 M34K possibly damaging Het
Olfr910 A G 9: 38,539,410 N172D probably damaging Het
Parp8 A T 13: 116,867,073 Y769* probably null Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phldb1 T C 9: 44,711,161 E65G probably damaging Het
Ppif C T 14: 25,698,326 T157M probably damaging Het
Ppp3ca T A 3: 136,932,225 probably null Het
Proser1 T A 3: 53,472,088 probably null Het
Reg3d T A 6: 78,376,079 K174* probably null Het
Rubcn A T 16: 32,856,950 L55Q probably damaging Het
Sec14l3 T C 11: 4,066,198 L39P probably damaging Het
Ska3 A G 14: 57,826,102 I4T probably damaging Het
Slc30a10 A G 1: 185,464,154 I338V possibly damaging Het
Slc35g1 C G 19: 38,402,829 S186R probably damaging Het
Slc35g1 T A 19: 38,402,831 L187H probably damaging Het
Spata5 T C 3: 37,431,782 S218P probably benign Het
Tbc1d5 T C 17: 50,742,086 I659V probably benign Het
Tbl3 G T 17: 24,700,916 D751E probably benign Het
Tdrd3 T A 14: 87,486,266 D311E possibly damaging Het
Tenm4 T C 7: 96,854,728 F1335S probably benign Het
Tm2d1 A T 4: 98,375,023 C83S probably damaging Het
Tnfrsf22 A T 7: 143,638,373 V192D unknown Het
Trpm6 A G 19: 18,811,790 T575A probably damaging Het
Uri1 T C 7: 37,981,673 D102G possibly damaging Het
Vmn2r1 T A 3: 64,103,050 C570S probably damaging Het
Vps13a C T 19: 16,640,787 V2906I probably damaging Het
Zfp472 T C 17: 32,978,003 Y351H possibly damaging Het
Zfp874a G T 13: 67,443,234 Y110* probably null Het
Zfp986 T A 4: 145,899,305 N178K probably benign Het
Other mutations in Ccdc7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Ccdc7a APN 8 129026754 splice site probably benign
IGL01019:Ccdc7a APN 8 129061618 missense probably benign 0.05
IGL01553:Ccdc7a APN 8 129026591 splice site probably benign
IGL01577:Ccdc7a APN 8 128988763 missense probably damaging 0.96
IGL03114:Ccdc7a APN 8 129026689 missense possibly damaging 0.62
IGL03323:Ccdc7a APN 8 129058763 missense probably benign 0.02
R1517:Ccdc7a UTSW 8 129061681 missense probably damaging 0.99
R1804:Ccdc7a UTSW 8 128988766 nonsense probably null
R1957:Ccdc7a UTSW 8 128980135 missense probably damaging 0.99
R4926:Ccdc7a UTSW 8 128980054 intron probably benign
R4981:Ccdc7a UTSW 8 128984983 missense probably benign 0.35
R5193:Ccdc7a UTSW 8 128988797 missense probably benign 0.02
R5273:Ccdc7a UTSW 8 129061609 frame shift probably null
R5486:Ccdc7a UTSW 8 128985403 missense probably damaging 0.98
R5505:Ccdc7a UTSW 8 128980174 missense possibly damaging 0.73
R5562:Ccdc7a UTSW 8 129058785 missense possibly damaging 0.79
R5704:Ccdc7a UTSW 8 128980096 splice site probably benign
R6256:Ccdc7a UTSW 8 128935593 splice site probably null
R6273:Ccdc7a UTSW 8 128787338 missense probably damaging 0.97
R6366:Ccdc7a UTSW 8 128855992 missense unknown
R6455:Ccdc7a UTSW 8 128832610 missense probably damaging 0.97
R6778:Ccdc7a UTSW 8 128821120 missense possibly damaging 0.66
R6882:Ccdc7a UTSW 8 128797328 intron probably benign
R6891:Ccdc7a UTSW 8 129026638 missense probably damaging 1.00
R6906:Ccdc7a UTSW 8 128935681 missense unknown
R7028:Ccdc7a UTSW 8 128881594 missense unknown
R7046:Ccdc7a UTSW 8 129047619 missense probably damaging 0.99
R7073:Ccdc7a UTSW 8 128892385 missense possibly damaging 0.46
R7268:Ccdc7a UTSW 8 128881152 missense possibly damaging 0.66
R7454:Ccdc7a UTSW 8 128944516 missense unknown
R7643:Ccdc7a UTSW 8 128889811 missense probably damaging 1.00
R7733:Ccdc7a UTSW 8 128993052 missense probably damaging 1.00
R7792:Ccdc7a UTSW 8 128892437 missense possibly damaging 0.81
R7902:Ccdc7a UTSW 8 128836173 missense possibly damaging 0.46
R7946:Ccdc7a UTSW 8 128917146 missense probably damaging 0.97
R7983:Ccdc7a UTSW 8 128881078 missense possibly damaging 0.66
R8032:Ccdc7a UTSW 8 128825383 missense unknown
R8345:Ccdc7a UTSW 8 128798764 missense probably benign 0.01
R8372:Ccdc7a UTSW 8 128821104 missense possibly damaging 0.82
R8379:Ccdc7a UTSW 8 128964936 missense probably benign 0.03
R8472:Ccdc7a UTSW 8 129027657 missense probably damaging 0.99
R8478:Ccdc7a UTSW 8 128761369 missense possibly damaging 0.66
R8536:Ccdc7a UTSW 8 128790120 missense possibly damaging 0.66
R8671:Ccdc7a UTSW 8 128920467 missense probably damaging 0.99
R8696:Ccdc7a UTSW 8 128988763 missense probably damaging 0.96
R8813:Ccdc7a UTSW 8 128823461 missense possibly damaging 0.83
R8859:Ccdc7a UTSW 8 129061632 missense probably benign 0.44
R9208:Ccdc7a UTSW 8 128746001 missense possibly damaging 0.66
R9222:Ccdc7a UTSW 8 128799129 missense unknown
R9262:Ccdc7a UTSW 8 128759796 missense possibly damaging 0.66
R9299:Ccdc7a UTSW 8 128889838 missense probably benign 0.27
R9337:Ccdc7a UTSW 8 128889838 missense probably benign 0.27
R9357:Ccdc7a UTSW 8 128944655 critical splice acceptor site probably null
RF008:Ccdc7a UTSW 8 128964953 missense probably damaging 0.99
Z1176:Ccdc7a UTSW 8 129026663 missense probably benign 0.41
Z1177:Ccdc7a UTSW 8 128807924 missense possibly damaging 0.66
Z1190:Ccdc7a UTSW 8 128819895 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AAACCCCTTACCTCTTGCAG -3'
(R):5'- GTGCAAGTACTCCCCACTTAAG -3'

Sequencing Primer
(F):5'- ACTCACCATTTCTAATCCTGTAACAG -3'
(R):5'- GTACTCCCCACTTAAGTACAAATAGG -3'
Posted On 2020-06-30