Incidental Mutation 'R8108:Npat'
ID 630740
Institutional Source Beutler Lab
Gene Symbol Npat
Ensembl Gene ENSMUSG00000033054
Gene Name nuclear protein in the AT region
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8108 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 53537047-53574342 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 53571129 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 1379 (G1379V)
Ref Sequence ENSEMBL: ENSMUSP00000048709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035850]
AlphaFold Q8BMA5
Predicted Effect probably benign
Transcript: ENSMUST00000035850
AA Change: G1379V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000048709
Gene: ENSMUSG00000033054
AA Change: G1379V

DomainStartEndE-ValueType
LisH 3 35 3.09e-3 SMART
low complexity region 585 592 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
Pfam:NPAT_C 754 1420 4.7e-299 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 T A 12: 84,017,361 H414Q probably benign Het
Actrt2 A T 4: 154,667,036 D214E probably benign Het
Ccdc7a T C 8: 128,980,153 T332A unknown Het
Chd9 C T 8: 90,933,224 H271Y unknown Het
Depdc5 T G 5: 32,945,049 D966E probably benign Het
Dolpp1 A G 2: 30,396,246 Y119C probably benign Het
Dscam G C 16: 96,643,879 D1537E probably benign Het
Dusp16 A G 6: 134,739,873 I157T probably benign Het
Dyrk2 T C 10: 118,859,829 D508G probably benign Het
Endov T C 11: 119,507,411 V334A probably benign Het
Ep400 A T 5: 110,687,883 V1956E unknown Het
Erich3 A T 3: 154,720,115 Y83F possibly damaging Het
Fbrsl1 T C 5: 110,378,379 probably null Het
Gm1110 T C 9: 26,920,661 I65V probably damaging Het
Gm28374 A G 19: 6,082,200 V19A Het
Gm436 A T 4: 144,670,669 N164K probably benign Het
Gpr107 C A 2: 31,184,869 H336Q probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grm1 C A 10: 10,720,132 R584L probably benign Het
Gse1 T C 8: 120,229,810 S347P unknown Het
Ier3ip1 T A 18: 76,940,525 I69K possibly damaging Het
Impact T G 18: 12,984,331 L154V probably benign Het
Katnb1 T C 8: 95,093,945 F141S possibly damaging Het
Kifap3 T A 1: 163,797,362 N162K probably damaging Het
Klhl5 A G 5: 65,148,587 probably null Het
Klre1 A G 6: 129,584,222 D182G probably benign Het
Krt42 T A 11: 100,266,957 Y227F probably benign Het
Lhcgr T A 17: 88,742,050 K683* probably null Het
Lrrc37a G A 11: 103,503,057 S514F probably benign Het
Lrrc9 G T 12: 72,454,059 L186F probably damaging Het
Metrn A G 17: 25,795,030 V274A probably benign Het
Mettl25 A T 10: 105,823,179 F414L possibly damaging Het
Mixl1 A G 1: 180,696,702 V104A probably damaging Het
Myo9b T A 8: 71,348,342 M1047K probably damaging Het
Nbea G A 3: 55,819,315 A2081V probably benign Het
Ndufs1 A T 1: 63,150,012 D551E possibly damaging Het
Nectin3 T C 16: 46,464,121 T67A possibly damaging Het
Nme8 C T 13: 19,650,960 V519I probably benign Het
Obscn T A 11: 59,061,634 T3870S probably benign Het
Olfr1000 T C 2: 85,608,749 R54G possibly damaging Het
Olfr1288 T C 2: 111,479,234 V150A possibly damaging Het
Olfr177 T C 16: 58,872,236 M305V probably benign Het
Olfr379-ps1 T A 11: 73,433,854 H124L unknown Het
Olfr871 T A 9: 20,212,451 M34K possibly damaging Het
Olfr910 A G 9: 38,539,410 N172D probably damaging Het
Parp8 A T 13: 116,867,073 Y769* probably null Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phldb1 T C 9: 44,711,161 E65G probably damaging Het
Ppif C T 14: 25,698,326 T157M probably damaging Het
Ppp3ca T A 3: 136,932,225 probably null Het
Proser1 T A 3: 53,472,088 probably null Het
Reg3d T A 6: 78,376,079 K174* probably null Het
Rubcn A T 16: 32,856,950 L55Q probably damaging Het
Sec14l3 T C 11: 4,066,198 L39P probably damaging Het
Ska3 A G 14: 57,826,102 I4T probably damaging Het
Slc30a10 A G 1: 185,464,154 I338V possibly damaging Het
Slc35g1 C G 19: 38,402,829 S186R probably damaging Het
Slc35g1 T A 19: 38,402,831 L187H probably damaging Het
Spata5 T C 3: 37,431,782 S218P probably benign Het
Tbc1d5 T C 17: 50,742,086 I659V probably benign Het
Tbl3 G T 17: 24,700,916 D751E probably benign Het
Tdrd3 T A 14: 87,486,266 D311E possibly damaging Het
Tenm4 T C 7: 96,854,728 F1335S probably benign Het
Tm2d1 A T 4: 98,375,023 C83S probably damaging Het
Tnfrsf22 A T 7: 143,638,373 V192D unknown Het
Trpm6 A G 19: 18,811,790 T575A probably damaging Het
Uri1 T C 7: 37,981,673 D102G possibly damaging Het
Vmn2r1 T A 3: 64,103,050 C570S probably damaging Het
Vps13a C T 19: 16,640,787 V2906I probably damaging Het
Zfp472 T C 17: 32,978,003 Y351H possibly damaging Het
Zfp874a G T 13: 67,443,234 Y110* probably null Het
Zfp986 T A 4: 145,899,305 N178K probably benign Het
Other mutations in Npat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Npat APN 9 53566800 missense possibly damaging 0.82
IGL00503:Npat APN 9 53572649 utr 3 prime probably benign
IGL00694:Npat APN 9 53563517 missense probably benign 0.00
IGL00731:Npat APN 9 53562086 missense probably damaging 0.99
IGL00907:Npat APN 9 53563290 missense possibly damaging 0.64
IGL00949:Npat APN 9 53563362 missense probably benign 0.17
IGL01403:Npat APN 9 53555129 missense probably benign 0.02
IGL01626:Npat APN 9 53556571 missense possibly damaging 0.92
IGL01936:Npat APN 9 53558226 splice site probably benign
IGL02142:Npat APN 9 53569907 missense probably benign
IGL02215:Npat APN 9 53559117 missense probably benign 0.00
IGL02250:Npat APN 9 53548951 nonsense probably null
IGL02624:Npat APN 9 53566810 missense probably damaging 1.00
IGL02928:Npat APN 9 53566838 splice site probably benign
IGL02931:Npat APN 9 53571041 nonsense probably null
IGL03128:Npat APN 9 53550033 splice site probably benign
IGL03238:Npat APN 9 53570426 missense probably damaging 0.98
Flotsam UTSW 9 53570570 nonsense probably null
kindling UTSW 9 53563449 missense probably damaging 0.99
R0606:Npat UTSW 9 53556481 critical splice donor site probably null
R0688:Npat UTSW 9 53570222 missense probably benign 0.18
R0839:Npat UTSW 9 53545180 missense probably damaging 0.99
R0947:Npat UTSW 9 53570324 missense probably benign 0.08
R1070:Npat UTSW 9 53572592 missense probably damaging 1.00
R1480:Npat UTSW 9 53563066 frame shift probably null
R1599:Npat UTSW 9 53562404 missense possibly damaging 0.62
R1644:Npat UTSW 9 53570172 missense probably damaging 1.00
R1646:Npat UTSW 9 53555134 missense probably benign 0.32
R1699:Npat UTSW 9 53562660 missense probably benign
R1765:Npat UTSW 9 53570222 missense probably benign 0.00
R1793:Npat UTSW 9 53552289 missense probably damaging 1.00
R1866:Npat UTSW 9 53563116 missense probably damaging 1.00
R1898:Npat UTSW 9 53563637 missense probably damaging 1.00
R2018:Npat UTSW 9 53562491 missense probably benign 0.34
R2019:Npat UTSW 9 53562491 missense probably benign 0.34
R2213:Npat UTSW 9 53552381 missense probably benign 0.00
R2432:Npat UTSW 9 53558135 missense probably damaging 1.00
R3816:Npat UTSW 9 53569916 missense probably damaging 0.99
R4764:Npat UTSW 9 53572620 missense probably damaging 1.00
R4889:Npat UTSW 9 53562207 missense probably benign 0.00
R4895:Npat UTSW 9 53570489 missense probably damaging 1.00
R4923:Npat UTSW 9 53571030 missense probably damaging 1.00
R5377:Npat UTSW 9 53550036 critical splice acceptor site probably null
R5397:Npat UTSW 9 53570474 missense probably damaging 1.00
R5504:Npat UTSW 9 53570264 missense probably benign 0.01
R5509:Npat UTSW 9 53570242 missense probably benign 0.00
R5563:Npat UTSW 9 53563127 missense probably damaging 0.97
R5677:Npat UTSW 9 53555100 missense probably benign 0.00
R5868:Npat UTSW 9 53570124 missense probably damaging 0.96
R5927:Npat UTSW 9 53562221 nonsense probably null
R6009:Npat UTSW 9 53563449 missense probably damaging 0.99
R6247:Npat UTSW 9 53545238 missense probably damaging 1.00
R6434:Npat UTSW 9 53563439 missense possibly damaging 0.81
R6784:Npat UTSW 9 53558158 missense probably damaging 1.00
R6799:Npat UTSW 9 53551630 missense probably benign 0.21
R6878:Npat UTSW 9 53556599 missense probably benign
R7027:Npat UTSW 9 53569916 missense possibly damaging 0.90
R7383:Npat UTSW 9 53562778 missense probably benign
R7404:Npat UTSW 9 53554933 splice site probably null
R7408:Npat UTSW 9 53569916 missense probably damaging 0.99
R7444:Npat UTSW 9 53548910 missense probably damaging 0.97
R7755:Npat UTSW 9 53559170 missense possibly damaging 0.92
R7992:Npat UTSW 9 53562867 missense probably benign 0.00
R8126:Npat UTSW 9 53552334 missense probably benign
R8213:Npat UTSW 9 53570570 nonsense probably null
R8354:Npat UTSW 9 53566951 missense possibly damaging 0.93
R8429:Npat UTSW 9 53570609 nonsense probably null
R8454:Npat UTSW 9 53566951 missense possibly damaging 0.93
R8865:Npat UTSW 9 53570640 missense probably benign 0.00
R8894:Npat UTSW 9 53556651 missense probably damaging 1.00
R9045:Npat UTSW 9 53563476 missense possibly damaging 0.83
R9375:Npat UTSW 9 53563156 missense possibly damaging 0.69
Z1177:Npat UTSW 9 53566828 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AACAGTGTGAGCATGGCTG -3'
(R):5'- CAGAAACATTCACTTTTCCTCAGG -3'

Sequencing Primer
(F):5'- GCCCACACGCTCATGATTC -3'
(R):5'- CCTCAGGATGATACATAGACAACTTG -3'
Posted On 2020-06-30