Mutagenetix > Incidental Mutations

Incidental Mutation 'R8108:Grm1'

630741

Institutional Source

Beutler Lab

Gene Symbol

Grm1

Ensembl Gene

ENSMUSG00000019828

Gene Name

glutamate receptor, metabotropic 1

Synonyms

Grm1, Gprc1a, mGluR1, nmf373, rcw, 4930455H15Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.409) question?

Stock #

R8108 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

10686059-11082356 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 10720132 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 584 (R584L)

Ref Sequence

ENSEMBL: ENSMUSP00000037255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044306] [ENSMUST00000105560] [ENSMUST00000105561]

AlphaFold

P97772

Predicted Effect

probably benign
Transcript: ENSMUST00000044306
AA Change: R584L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000037255
Gene: ENSMUSG00000019828
AA Change: R584L

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	77	485	1.1e-94	PFAM
Pfam:Peripla_BP_6	151	340	1.4e-10	PFAM
Pfam:NCD3G	521	571	5.5e-16	PFAM
Pfam:7tm_3	604	837	2.4e-55	PFAM
low complexity region	969	975	N/A	INTRINSIC
low complexity region	983	993	N/A	INTRINSIC
low complexity region	1013	1033	N/A	INTRINSIC
low complexity region	1071	1088	N/A	INTRINSIC
low complexity region	1093	1109	N/A	INTRINSIC
low complexity region	1126	1136	N/A	INTRINSIC
GluR_Homer-bdg	1149	1199	6.85e-27	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000105560
AA Change: R584L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000101189
Gene: ENSMUSG00000019828
AA Change: R584L

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	77	485	2e-92	PFAM
Pfam:Peripla_BP_6	152	347	2.7e-12	PFAM
Pfam:NCD3G	520	571	2.7e-19	PFAM
Pfam:7tm_3	602	838	3.2e-73	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105561
AA Change: R584L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000101190
Gene: ENSMUSG00000019828
AA Change: R584L

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:ANF_receptor	77	485	2e-92	PFAM
Pfam:Peripla_BP_6	152	347	2.7e-12	PFAM
Pfam:NCD3G	520	571	2.7e-19	PFAM
Pfam:7tm_3	602	838	3.2e-73	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.0%
20x: 97.3%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metabotropic glutamate receptor that functions by activating phospholipase C. L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The canonical alpha isoform of the encoded protein is a disulfide-linked homodimer whose activity is mediated by a G-protein-coupled phosphatidylinositol-calcium second messenger system. This gene may be associated with many disease states, including schizophrenia, bipolar disorder, depression, and breast cancer. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for null mutations show impairements in motor coordination, spatial learning, hippocampal mossy fiber long-term potentiation, and cerebellar long-term depression. Homozygotes for a spontaneous mutation are small and exhibit ataxia, kyphoscoliosis, albuminuria and glomerular damage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot1	T	A	12: 84,017,361	H414Q	probably benign	Het
Actrt2	A	T	4: 154,667,036	D214E	probably benign	Het
Ccdc7a	T	C	8: 128,980,153	T332A	unknown	Het
Chd9	C	T	8: 90,933,224	H271Y	unknown	Het
Depdc5	T	G	5: 32,945,049	D966E	probably benign	Het
Dolpp1	A	G	2: 30,396,246	Y119C	probably benign	Het
Dscam	G	C	16: 96,643,879	D1537E	probably benign	Het
Dusp16	A	G	6: 134,739,873	I157T	probably benign	Het
Dyrk2	T	C	10: 118,859,829	D508G	probably benign	Het
Endov	T	C	11: 119,507,411	V334A	probably benign	Het
Ep400	A	T	5: 110,687,883	V1956E	unknown	Het
Erich3	A	T	3: 154,720,115	Y83F	possibly damaging	Het
Fbrsl1	T	C	5: 110,378,379		probably null	Het
Gm1110	T	C	9: 26,920,661	I65V	probably damaging	Het
Gm28374	A	G	19: 6,082,200	V19A		Het
Gm436	A	T	4: 144,670,669	N164K	probably benign	Het
Gpr107	C	A	2: 31,184,869	H336Q	probably damaging	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Gse1	T	C	8: 120,229,810	S347P	unknown	Het
Ier3ip1	T	A	18: 76,940,525	I69K	possibly damaging	Het
Impact	T	G	18: 12,984,331	L154V	probably benign	Het
Katnb1	T	C	8: 95,093,945	F141S	possibly damaging	Het
Kifap3	T	A	1: 163,797,362	N162K	probably damaging	Het
Klhl5	A	G	5: 65,148,587		probably null	Het
Klre1	A	G	6: 129,584,222	D182G	probably benign	Het
Krt42	T	A	11: 100,266,957	Y227F	probably benign	Het
Lhcgr	T	A	17: 88,742,050	K683*	probably null	Het
Lrrc37a	G	A	11: 103,503,057	S514F	probably benign	Het
Lrrc9	G	T	12: 72,454,059	L186F	probably damaging	Het
Metrn	A	G	17: 25,795,030	V274A	probably benign	Het
Mettl25	A	T	10: 105,823,179	F414L	possibly damaging	Het
Mixl1	A	G	1: 180,696,702	V104A	probably damaging	Het
Myo9b	T	A	8: 71,348,342	M1047K	probably damaging	Het
Nbea	G	A	3: 55,819,315	A2081V	probably benign	Het
Ndufs1	A	T	1: 63,150,012	D551E	possibly damaging	Het
Nectin3	T	C	16: 46,464,121	T67A	possibly damaging	Het
Nme8	C	T	13: 19,650,960	V519I	probably benign	Het
Npat	G	T	9: 53,571,129	G1379V	probably benign	Het
Obscn	T	A	11: 59,061,634	T3870S	probably benign	Het
Olfr1000	T	C	2: 85,608,749	R54G	possibly damaging	Het
Olfr1288	T	C	2: 111,479,234	V150A	possibly damaging	Het
Olfr177	T	C	16: 58,872,236	M305V	probably benign	Het
Olfr379-ps1	T	A	11: 73,433,854	H124L	unknown	Het
Olfr871	T	A	9: 20,212,451	M34K	possibly damaging	Het
Olfr910	A	G	9: 38,539,410	N172D	probably damaging	Het
Parp8	A	T	13: 116,867,073	Y769*	probably null	Het
Pcnx	C	T	12: 81,918,819	R59*	probably null	Het
Pdzd2	G	A	15: 12,373,506	S2181L	probably benign	Het
Phldb1	T	C	9: 44,711,161	E65G	probably damaging	Het
Ppif	C	T	14: 25,698,326	T157M	probably damaging	Het
Ppp3ca	T	A	3: 136,932,225		probably null	Het
Proser1	T	A	3: 53,472,088		probably null	Het
Reg3d	T	A	6: 78,376,079	K174*	probably null	Het
Rubcn	A	T	16: 32,856,950	L55Q	probably damaging	Het
Sec14l3	T	C	11: 4,066,198	L39P	probably damaging	Het
Ska3	A	G	14: 57,826,102	I4T	probably damaging	Het
Slc30a10	A	G	1: 185,464,154	I338V	possibly damaging	Het
Slc35g1	C	G	19: 38,402,829	S186R	probably damaging	Het
Slc35g1	T	A	19: 38,402,831	L187H	probably damaging	Het
Spata5	T	C	3: 37,431,782	S218P	probably benign	Het
Tbc1d5	T	C	17: 50,742,086	I659V	probably benign	Het
Tbl3	G	T	17: 24,700,916	D751E	probably benign	Het
Tdrd3	T	A	14: 87,486,266	D311E	possibly damaging	Het
Tenm4	T	C	7: 96,854,728	F1335S	probably benign	Het
Tm2d1	A	T	4: 98,375,023	C83S	probably damaging	Het
Tnfrsf22	A	T	7: 143,638,373	V192D	unknown	Het
Trpm6	A	G	19: 18,811,790	T575A	probably damaging	Het
Uri1	T	C	7: 37,981,673	D102G	possibly damaging	Het
Vmn2r1	T	A	3: 64,103,050	C570S	probably damaging	Het
Vps13a	C	T	19: 16,640,787	V2906I	probably damaging	Het
Zfp472	T	C	17: 32,978,003	Y351H	possibly damaging	Het
Zfp874a	G	T	13: 67,443,234	Y110*	probably null	Het
Zfp986	T	A	4: 145,899,305	N178K	probably benign	Het

Other mutations in Grm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01371:Grm1	APN	10	10720039	missense	probably benign	0.01
IGL02078:Grm1	APN	10	10689610	missense	probably benign	0.02
IGL02156:Grm1	APN	10	10719976	missense	probably damaging	0.99
IGL02476:Grm1	APN	10	10689453	missense	probably benign	0.29
IGL02498:Grm1	APN	10	10719979	missense	probably damaging	1.00
IGL02621:Grm1	APN	10	10689011	nonsense	probably null
IGL03192:Grm1	APN	10	11079916	missense	possibly damaging	0.66
IGL03342:Grm1	APN	10	11079971	missense	probably benign	0.08
dewey	UTSW	10	10719595	missense	probably damaging	1.00
Dingus	UTSW	10	10719967	missense	probably benign	0.06
donald	UTSW	10	10741508	nonsense	probably null
jim	UTSW	10	10719805	missense	probably damaging	1.00
lightness	UTSW	10	11079958	missense	probably damaging	1.00
IGL02796:Grm1	UTSW	10	10689667	missense	probably benign
R0294:Grm1	UTSW	10	11080399	missense	probably damaging	1.00
R0525:Grm1	UTSW	10	10719209	splice site	probably benign
R0554:Grm1	UTSW	10	10719923	missense	probably benign	0.01
R1184:Grm1	UTSW	10	10720034	missense	probably benign	0.40
R1319:Grm1	UTSW	10	10689398	missense	probably benign	0.05
R1403:Grm1	UTSW	10	11080135	missense	probably benign	0.00
R1403:Grm1	UTSW	10	11080135	missense	probably benign	0.00
R1467:Grm1	UTSW	10	10719958	missense	probably damaging	1.00
R1467:Grm1	UTSW	10	10719958	missense	probably damaging	1.00
R1494:Grm1	UTSW	10	10689706	missense	probably benign	0.04
R1589:Grm1	UTSW	10	10719967	missense	probably benign	0.06
R1615:Grm1	UTSW	10	10741508	nonsense	probably null
R1720:Grm1	UTSW	10	10746794	splice site	probably null
R1738:Grm1	UTSW	10	10936419	missense	probably damaging	1.00
R1763:Grm1	UTSW	10	11079866	missense	possibly damaging	0.47
R1774:Grm1	UTSW	10	11079866	missense	possibly damaging	0.47
R2041:Grm1	UTSW	10	10746603	missense	probably damaging	0.98
R2092:Grm1	UTSW	10	10689225	missense	probably benign	0.00
R2198:Grm1	UTSW	10	10782776	missense	probably damaging	1.00
R2297:Grm1	UTSW	10	11080414	missense	probably benign	0.03
R2333:Grm1	UTSW	10	10719346	missense	probably damaging	0.98
R2333:Grm1	UTSW	10	10719619	missense	probably benign	0.31
R2914:Grm1	UTSW	10	11079857	missense	probably benign	0.07
R3105:Grm1	UTSW	10	11079857	missense	probably benign	0.07
R3106:Grm1	UTSW	10	11079857	missense	probably benign	0.07
R3705:Grm1	UTSW	10	10782729	missense	possibly damaging	0.95
R3931:Grm1	UTSW	10	10719878	missense	probably benign	0.44
R4810:Grm1	UTSW	10	10782694	missense	probably damaging	1.00
R4892:Grm1	UTSW	10	10719587	missense	possibly damaging	0.81
R4938:Grm1	UTSW	10	10936513	missense	probably damaging	1.00
R4947:Grm1	UTSW	10	10782633	missense	probably damaging	1.00
R4966:Grm1	UTSW	10	10719665	nonsense	probably null
R5152:Grm1	UTSW	10	11079875	missense	probably benign	0.13
R5283:Grm1	UTSW	10	10733192	missense	possibly damaging	0.70
R5317:Grm1	UTSW	10	10746699	missense	possibly damaging	0.77
R5374:Grm1	UTSW	10	11080442	missense	probably benign	0.14
R5428:Grm1	UTSW	10	10719563	missense	probably damaging	1.00
R5604:Grm1	UTSW	10	10746735	missense	probably damaging	1.00
R5894:Grm1	UTSW	10	11080255	missense	probably damaging	1.00
R5896:Grm1	UTSW	10	11080550	utr 5 prime	probably benign
R5899:Grm1	UTSW	10	10689348	missense	probably benign
R6032:Grm1	UTSW	10	10719805	missense	probably damaging	1.00
R6032:Grm1	UTSW	10	10719805	missense	probably damaging	1.00
R6139:Grm1	UTSW	10	10746331	intron	probably benign
R6144:Grm1	UTSW	10	11079896	missense	probably benign	0.08
R6208:Grm1	UTSW	10	10719946	missense	probably damaging	1.00
R6976:Grm1	UTSW	10	10689180	missense	probably benign	0.00
R7027:Grm1	UTSW	10	10719595	missense	probably damaging	1.00
R7079:Grm1	UTSW	10	11079958	missense	probably damaging	1.00
R7286:Grm1	UTSW	10	10689696	missense	probably benign	0.19
R7352:Grm1	UTSW	10	10719493	missense	probably damaging	1.00
R7484:Grm1	UTSW	10	10746659	missense	probably benign	0.06
R7838:Grm1	UTSW	10	11080352	missense	probably benign	0.02
R8379:Grm1	UTSW	10	10689135	missense	possibly damaging	0.86
R8498:Grm1	UTSW	10	11079861	nonsense	probably null
R8712:Grm1	UTSW	10	10689552	missense	probably benign	0.34
R8856:Grm1	UTSW	10	10719348	missense	probably damaging	1.00
R8904:Grm1	UTSW	10	10719537	missense	probably damaging	1.00
R9043:Grm1	UTSW	10	10689312	nonsense	probably null
R9477:Grm1	UTSW	10	10719661	missense	probably benign	0.15
X0002:Grm1	UTSW	10	10936513	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGCCGAGGAAAATACCAGC -3'
(R):5'- TCTGACTGTGATGACACTAAGC -3'

Sequencing Primer
(F):5'- GCCAGAATGATATAGCAGAGCTCTC -3'
(R):5'- TTATCCAGGGAAGGCAATCTC -3'

Posted On

2020-06-30