Mutagenetix > Incidental Mutation

Incidental Mutation 'R8108:Dyrk2'

630743

Institutional Source

Beutler Lab

Gene Symbol

Dyrk2

Ensembl Gene

ENSMUSG00000028630

Gene Name

dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2

Synonyms

1810038L18Rik

MMRRC Submission

067537-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.535) question?

Stock #

R8108 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

118855603-118870209 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 118859829 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 508 (D508G)

Ref Sequence

ENSEMBL: ENSMUSP00000004281 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004281]

AlphaFold

Q5U4C9

Predicted Effect

probably benign
Transcript: ENSMUST00000004281
AA Change: D508G

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000004281
Gene: ENSMUSG00000028630
AA Change: D508G

Domain	Start	End	E-Value	Type
S_TKc	220	533	1.16e-92	SMART
low complexity region	560	574	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.0%
20x: 97.3%

Validation Efficiency

99% (72/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DYRK2 belongs to a family of protein kinases whose members are presumed to be involved in cellular growth and/or development. The family is defined by structural similarity of their kinase domains and their capability to autophosphorylate on tyrosine residues. DYRK2 has demonstrated tyrosine autophosphorylation and catalyzed phosphorylation of histones H3 and H2B in vitro. Two isoforms of DYRK2 have been isolated. The predominant isoform, isoform 1, lacks a 5' terminal insert. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot1	T	A	12: 84,017,361	H414Q	probably benign	Het
Actrt2	A	T	4: 154,667,036	D214E	probably benign	Het
Ccdc7a	T	C	8: 128,980,153	T332A	unknown	Het
Chd9	C	T	8: 90,933,224	H271Y	unknown	Het
Depdc5	T	G	5: 32,945,049	D966E	probably benign	Het
Dolpp1	A	G	2: 30,396,246	Y119C	probably benign	Het
Dscam	G	C	16: 96,643,879	D1537E	probably benign	Het
Dusp16	A	G	6: 134,739,873	I157T	probably benign	Het
Endov	T	C	11: 119,507,411	V334A	probably benign	Het
Ep400	A	T	5: 110,687,883	V1956E	unknown	Het
Erich3	A	T	3: 154,720,115	Y83F	possibly damaging	Het
Fbrsl1	T	C	5: 110,378,379		probably null	Het
Gm1110	T	C	9: 26,920,661	I65V	probably damaging	Het
Gm28374	A	G	19: 6,082,200	V19A		Het
Gm436	A	T	4: 144,670,669	N164K	probably benign	Het
Gpr107	C	A	2: 31,184,869	H336Q	probably damaging	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Grm1	C	A	10: 10,720,132	R584L	probably benign	Het
Gse1	T	C	8: 120,229,810	S347P	unknown	Het
Ier3ip1	T	A	18: 76,940,525	I69K	possibly damaging	Het
Impact	T	G	18: 12,984,331	L154V	probably benign	Het
Katnb1	T	C	8: 95,093,945	F141S	possibly damaging	Het
Kifap3	T	A	1: 163,797,362	N162K	probably damaging	Het
Klhl5	A	G	5: 65,148,587		probably null	Het
Klre1	A	G	6: 129,584,222	D182G	probably benign	Het
Krt42	T	A	11: 100,266,957	Y227F	probably benign	Het
Lhcgr	T	A	17: 88,742,050	K683*	probably null	Het
Lrrc37a	G	A	11: 103,503,057	S514F	probably benign	Het
Lrrc9	G	T	12: 72,454,059	L186F	probably damaging	Het
Metrn	A	G	17: 25,795,030	V274A	probably benign	Het
Mettl25	A	T	10: 105,823,179	F414L	possibly damaging	Het
Mixl1	A	G	1: 180,696,702	V104A	probably damaging	Het
Myo9b	T	A	8: 71,348,342	M1047K	probably damaging	Het
Nbea	G	A	3: 55,819,315	A2081V	probably benign	Het
Ndufs1	A	T	1: 63,150,012	D551E	possibly damaging	Het
Nectin3	T	C	16: 46,464,121	T67A	possibly damaging	Het
Nme8	C	T	13: 19,650,960	V519I	probably benign	Het
Npat	G	T	9: 53,571,129	G1379V	probably benign	Het
Obscn	T	A	11: 59,061,634	T3870S	probably benign	Het
Olfr1000	T	C	2: 85,608,749	R54G	possibly damaging	Het
Olfr1288	T	C	2: 111,479,234	V150A	possibly damaging	Het
Olfr177	T	C	16: 58,872,236	M305V	probably benign	Het
Olfr379-ps1	T	A	11: 73,433,854	H124L	unknown	Het
Olfr871	T	A	9: 20,212,451	M34K	possibly damaging	Het
Olfr910	A	G	9: 38,539,410	N172D	probably damaging	Het
Parp8	A	T	13: 116,867,073	Y769*	probably null	Het
Pcnx	C	T	12: 81,918,819	R59*	probably null	Het
Pdzd2	G	A	15: 12,373,506	S2181L	probably benign	Het
Phldb1	T	C	9: 44,711,161	E65G	probably damaging	Het
Ppif	C	T	14: 25,698,326	T157M	probably damaging	Het
Ppp3ca	T	A	3: 136,932,225		probably null	Het
Proser1	T	A	3: 53,472,088		probably null	Het
Reg3d	T	A	6: 78,376,079	K174*	probably null	Het
Rubcn	A	T	16: 32,856,950	L55Q	probably damaging	Het
Sec14l3	T	C	11: 4,066,198	L39P	probably damaging	Het
Ska3	A	G	14: 57,826,102	I4T	probably damaging	Het
Slc30a10	A	G	1: 185,464,154	I338V	possibly damaging	Het
Slc35g1	C	G	19: 38,402,829	S186R	probably damaging	Het
Slc35g1	T	A	19: 38,402,831	L187H	probably damaging	Het
Spata5	T	C	3: 37,431,782	S218P	probably benign	Het
Tbc1d5	T	C	17: 50,742,086	I659V	probably benign	Het
Tbl3	G	T	17: 24,700,916	D751E	probably benign	Het
Tdrd3	T	A	14: 87,486,266	D311E	possibly damaging	Het
Tenm4	T	C	7: 96,854,728	F1335S	probably benign	Het
Tm2d1	A	T	4: 98,375,023	C83S	probably damaging	Het
Tnfrsf22	A	T	7: 143,638,373	V192D	unknown	Het
Trpm6	A	G	19: 18,811,790	T575A	probably damaging	Het
Uri1	T	C	7: 37,981,673	D102G	possibly damaging	Het
Vmn2r1	T	A	3: 64,103,050	C570S	probably damaging	Het
Vps13a	C	T	19: 16,640,787	V2906I	probably damaging	Het
Zfp472	T	C	17: 32,978,003	Y351H	possibly damaging	Het
Zfp874a	G	T	13: 67,443,234	Y110*	probably null	Het
Zfp986	T	A	4: 145,899,305	N178K	probably benign	Het

Other mutations in Dyrk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Dyrk2	APN	10	118859844	missense	probably damaging	1.00
IGL00536:Dyrk2	APN	10	118860192	missense	probably damaging	1.00
IGL01288:Dyrk2	APN	10	118860699	missense	probably damaging	1.00
IGL01375:Dyrk2	APN	10	118860687	missense	probably damaging	1.00
IGL01637:Dyrk2	APN	10	118860507	missense	probably damaging	1.00
IGL02052:Dyrk2	APN	10	118860543	missense	probably damaging	1.00
R0452:Dyrk2	UTSW	10	118868763	missense	possibly damaging	0.91
R0833:Dyrk2	UTSW	10	118861122	missense	probably benign	0.00
R0836:Dyrk2	UTSW	10	118861122	missense	probably benign	0.00
R1346:Dyrk2	UTSW	10	118859719	missense	possibly damaging	0.92
R1610:Dyrk2	UTSW	10	118859925	missense	probably benign	0.02
R2397:Dyrk2	UTSW	10	118861368	intron	probably benign
R2409:Dyrk2	UTSW	10	118860627	missense	probably benign
R2965:Dyrk2	UTSW	10	118860337	nonsense	probably null
R2966:Dyrk2	UTSW	10	118860337	nonsense	probably null
R4700:Dyrk2	UTSW	10	118868286	missense	probably benign
R4896:Dyrk2	UTSW	10	118868248	missense	probably damaging	0.96
R4978:Dyrk2	UTSW	10	118860347	missense	probably benign	0.00
R5393:Dyrk2	UTSW	10	118859848	missense	probably damaging	0.98
R5442:Dyrk2	UTSW	10	118860738	missense	possibly damaging	0.72
R5496:Dyrk2	UTSW	10	118860051	missense	probably damaging	1.00
R5810:Dyrk2	UTSW	10	118860340	missense	probably benign	0.16
R5875:Dyrk2	UTSW	10	118860697	missense	probably damaging	1.00
R5930:Dyrk2	UTSW	10	118860268	missense	probably damaging	1.00
R6877:Dyrk2	UTSW	10	118860423	missense	probably damaging	1.00
R7234:Dyrk2	UTSW	10	118860231	missense	possibly damaging	0.84
R7442:Dyrk2	UTSW	10	118859881	missense	probably damaging	1.00
R7741:Dyrk2	UTSW	10	118859689	missense	probably benign
R8137:Dyrk2	UTSW	10	118859884	missense	probably benign	0.00
R8347:Dyrk2	UTSW	10	118859983	missense	probably damaging	0.99
R8507:Dyrk2	UTSW	10	118860662	missense	probably damaging	1.00
R8517:Dyrk2	UTSW	10	118861021	missense	probably benign
R8695:Dyrk2	UTSW	10	118861017	missense	probably benign	0.00
R9018:Dyrk2	UTSW	10	118860109	missense	probably damaging	0.99
R9619:Dyrk2	UTSW	10	118860387	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTGGCATCTGTCATCTGTGC -3'
(R):5'- ATTTCGTGAGCTCCAAGGG -3'

Sequencing Primer
(F):5'- CCAAGTTAGTCCTCAGCTTGGAAG -3'
(R):5'- ATTTCGTGAGCTCCAAGGGTTACC -3'

Posted On

2020-06-30