Incidental Mutation 'R8108:Sec14l3'
ID630744
Institutional Source Beutler Lab
Gene Symbol Sec14l3
Ensembl Gene ENSMUSG00000054986
Gene NameSEC14-like lipid binding 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R8108 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location4064841-4077736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4066198 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 39 (L39P)
Ref Sequence ENSEMBL: ENSMUSP00000065084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068322]
Predicted Effect probably damaging
Transcript: ENSMUST00000068322
AA Change: L39P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065084
Gene: ENSMUSG00000054986
AA Change: L39P

DomainStartEndE-ValueType
CRAL_TRIO_N 34 59 2.71e-7 SMART
SEC14 76 247 1.18e-66 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the protein encoded by the Saccharomyces cerevisiae SEC14 gene. The SEC14 protein is a phophatidylinositol transfer protein that is essential for biogenesis of Golgi-derived transport vesicles, and thus is required for the export of yeast secretory proteins from the Golgi complex. The specific function of this protein has not yet been determined. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 T A 12: 84,017,361 H414Q probably benign Het
Actrt2 A T 4: 154,667,036 D214E probably benign Het
Ccdc7a T C 8: 128,980,153 T332A unknown Het
Chd9 C T 8: 90,933,224 H271Y unknown Het
Depdc5 T G 5: 32,945,049 D966E probably benign Het
Dolpp1 A G 2: 30,396,246 Y119C probably benign Het
Dscam G C 16: 96,643,879 D1537E probably benign Het
Dusp16 A G 6: 134,739,873 I157T probably benign Het
Dyrk2 T C 10: 118,859,829 D508G probably benign Het
Endov T C 11: 119,507,411 V334A probably benign Het
Ep400 A T 5: 110,687,883 V1956E unknown Het
Erich3 A T 3: 154,720,115 Y83F possibly damaging Het
Fbrsl1 T C 5: 110,378,379 probably null Het
Gm1110 T C 9: 26,920,661 I65V probably damaging Het
Gm28374 A G 19: 6,082,200 V19A Het
Gm436 A T 4: 144,670,669 N164K probably benign Het
Gpr107 C A 2: 31,184,869 H336Q probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Grm1 C A 10: 10,720,132 R584L probably benign Het
Gse1 T C 8: 120,229,810 S347P unknown Het
Ier3ip1 T A 18: 76,940,525 I69K possibly damaging Het
Impact T G 18: 12,984,331 L154V probably benign Het
Katnb1 T C 8: 95,093,945 F141S possibly damaging Het
Kifap3 T A 1: 163,797,362 N162K probably damaging Het
Klhl5 A G 5: 65,148,587 probably null Het
Klre1 A G 6: 129,584,222 D182G probably benign Het
Krt42 T A 11: 100,266,957 Y227F probably benign Het
Lhcgr T A 17: 88,742,050 K683* probably null Het
Lrrc37a G A 11: 103,503,057 S514F probably benign Het
Lrrc9 G T 12: 72,454,059 L186F probably damaging Het
Metrn A G 17: 25,795,030 V274A probably benign Het
Mettl25 A T 10: 105,823,179 F414L possibly damaging Het
Mixl1 A G 1: 180,696,702 V104A probably damaging Het
Myo9b T A 8: 71,348,342 M1047K probably damaging Het
Nbea G A 3: 55,819,315 A2081V probably benign Het
Ndufs1 A T 1: 63,150,012 D551E possibly damaging Het
Nectin3 T C 16: 46,464,121 T67A possibly damaging Het
Nme8 C T 13: 19,650,960 V519I probably benign Het
Npat G T 9: 53,571,129 G1379V probably benign Het
Obscn T A 11: 59,061,634 T3870S probably benign Het
Olfr1000 T C 2: 85,608,749 R54G possibly damaging Het
Olfr1288 T C 2: 111,479,234 V150A possibly damaging Het
Olfr177 T C 16: 58,872,236 M305V probably benign Het
Olfr379-ps1 T A 11: 73,433,854 H124L unknown Het
Olfr871 T A 9: 20,212,451 M34K possibly damaging Het
Olfr910 A G 9: 38,539,410 N172D probably damaging Het
Parp8 A T 13: 116,867,073 Y769* probably null Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phldb1 T C 9: 44,711,161 E65G probably damaging Het
Ppif C T 14: 25,698,326 T157M probably damaging Het
Ppp3ca T A 3: 136,932,225 probably null Het
Proser1 T A 3: 53,472,088 probably null Het
Reg3d T A 6: 78,376,079 K174* probably null Het
Rubcn A T 16: 32,856,950 L55Q probably damaging Het
Ska3 A G 14: 57,826,102 I4T probably damaging Het
Slc30a10 A G 1: 185,464,154 I338V possibly damaging Het
Slc35g1 C G 19: 38,402,829 S186R probably damaging Het
Slc35g1 T A 19: 38,402,831 L187H probably damaging Het
Spata5 T C 3: 37,431,782 S218P probably benign Het
Tbc1d5 T C 17: 50,742,086 I659V probably benign Het
Tbl3 G T 17: 24,700,916 D751E probably benign Het
Tdrd3 T A 14: 87,486,266 D311E possibly damaging Het
Tenm4 T C 7: 96,854,728 F1335S probably benign Het
Tm2d1 A T 4: 98,375,023 C83S probably damaging Het
Tnfrsf22 A T 7: 143,638,373 V192D unknown Het
Trpm6 A G 19: 18,811,790 T575A probably damaging Het
Uri1 T C 7: 37,981,673 D102G possibly damaging Het
Vmn2r1 T A 3: 64,103,050 C570S probably damaging Het
Vps13a C T 19: 16,640,787 V2906I probably damaging Het
Zfp472 T C 17: 32,978,003 Y351H possibly damaging Het
Zfp874a G T 13: 67,443,234 Y110* probably null Het
Zfp986 T A 4: 145,899,305 N178K probably benign Het
Other mutations in Sec14l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Sec14l3 APN 11 4076238 splice site probably benign
IGL01382:Sec14l3 APN 11 4068104 missense probably damaging 0.98
IGL02304:Sec14l3 APN 11 4074768 missense probably damaging 1.00
IGL02565:Sec14l3 APN 11 4076237 splice site probably benign
IGL02836:Sec14l3 APN 11 4070084 missense probably benign 0.02
R0183:Sec14l3 UTSW 11 4075547 missense probably benign 0.03
R0597:Sec14l3 UTSW 11 4074814 missense probably damaging 1.00
R1425:Sec14l3 UTSW 11 4066487 missense probably damaging 1.00
R1834:Sec14l3 UTSW 11 4066510 splice site probably benign
R2090:Sec14l3 UTSW 11 4075481 missense probably benign 0.00
R3839:Sec14l3 UTSW 11 4071544 splice site probably null
R4424:Sec14l3 UTSW 11 4066210 missense probably damaging 1.00
R4948:Sec14l3 UTSW 11 4068101 missense possibly damaging 0.75
R5124:Sec14l3 UTSW 11 4075209 missense possibly damaging 0.67
R5588:Sec14l3 UTSW 11 4066138 missense probably damaging 1.00
R5635:Sec14l3 UTSW 11 4071484 missense probably damaging 1.00
R6185:Sec14l3 UTSW 11 4075244 missense probably damaging 1.00
R6192:Sec14l3 UTSW 11 4075566 splice site probably null
R6699:Sec14l3 UTSW 11 4075193 missense possibly damaging 0.78
R7002:Sec14l3 UTSW 11 4075263 missense possibly damaging 0.87
R7351:Sec14l3 UTSW 11 4074785 missense probably benign 0.00
R7357:Sec14l3 UTSW 11 4070127 missense probably benign 0.03
R7845:Sec14l3 UTSW 11 4067972 missense probably benign 0.38
R7890:Sec14l3 UTSW 11 4074795 missense probably damaging 0.96
RF011:Sec14l3 UTSW 11 4067963 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTCAAGCTGAGTCAGACTGAGAG -3'
(R):5'- TAGGACAAGGCTGCCTTACC -3'

Sequencing Primer
(F):5'- CTGAGTCAGACTGAGAGACGGG -3'
(R):5'- TTACCTGCCACTAGTGAGAGCAATG -3'
Posted On2020-06-30