Incidental Mutation 'R8108:Parp8'
ID 630756
Institutional Source Beutler Lab
Gene Symbol Parp8
Ensembl Gene ENSMUSG00000021725
Gene Name poly (ADP-ribose) polymerase family, member 8
Synonyms D13Ertd275e, 2810430O08Rik
MMRRC Submission 067537-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8108 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 116991356-117162073 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 117003609 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 769 (Y769*)
Ref Sequence ENSEMBL: ENSMUSP00000022239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022239] [ENSMUST00000223949] [ENSMUST00000226107]
AlphaFold Q3UD82
Predicted Effect probably null
Transcript: ENSMUST00000022239
AA Change: Y769*
SMART Domains Protein: ENSMUSP00000022239
Gene: ENSMUSG00000021725
AA Change: Y769*

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
internal_repeat_1 332 410 4.61e-10 PROSPERO
internal_repeat_1 404 476 4.61e-10 PROSPERO
low complexity region 497 514 N/A INTRINSIC
Pfam:PARP 712 839 2e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000223949
AA Change: Y730*
Predicted Effect probably benign
Transcript: ENSMUST00000226107
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 A T 4: 144,397,239 (GRCm39) N164K probably benign Het
Acot1 T A 12: 84,064,135 (GRCm39) H414Q probably benign Het
Actrt2 A T 4: 154,751,493 (GRCm39) D214E probably benign Het
Afg2a T C 3: 37,485,931 (GRCm39) S218P probably benign Het
Ccdc7a T C 8: 129,706,634 (GRCm39) T332A unknown Het
Chd9 C T 8: 91,659,852 (GRCm39) H271Y unknown Het
Depdc5 T G 5: 33,102,393 (GRCm39) D966E probably benign Het
Dolpp1 A G 2: 30,286,258 (GRCm39) Y119C probably benign Het
Dscam G C 16: 96,445,079 (GRCm39) D1537E probably benign Het
Dusp16 A G 6: 134,716,836 (GRCm39) I157T probably benign Het
Dyrk2 T C 10: 118,695,734 (GRCm39) D508G probably benign Het
Endov T C 11: 119,398,237 (GRCm39) V334A probably benign Het
Ep400 A T 5: 110,835,749 (GRCm39) V1956E unknown Het
Erich3 A T 3: 154,425,752 (GRCm39) Y83F possibly damaging Het
Fbrsl1 T C 5: 110,526,245 (GRCm39) probably null Het
Gm1110 T C 9: 26,831,957 (GRCm39) I65V probably damaging Het
Gm28374 A G 19: 6,132,230 (GRCm39) V19A Het
Gpr107 C A 2: 31,074,881 (GRCm39) H336Q probably damaging Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Grm1 C A 10: 10,595,876 (GRCm39) R584L probably benign Het
Gse1 T C 8: 120,956,549 (GRCm39) S347P unknown Het
Ier3ip1 T A 18: 77,028,221 (GRCm39) I69K possibly damaging Het
Impact T G 18: 13,117,388 (GRCm39) L154V probably benign Het
Katnb1 T C 8: 95,820,573 (GRCm39) F141S possibly damaging Het
Kifap3 T A 1: 163,624,931 (GRCm39) N162K probably damaging Het
Klhl5 A G 5: 65,305,930 (GRCm39) probably null Het
Klre1 A G 6: 129,561,185 (GRCm39) D182G probably benign Het
Krt42 T A 11: 100,157,783 (GRCm39) Y227F probably benign Het
Lhcgr T A 17: 89,049,478 (GRCm39) K683* probably null Het
Lrrc37a G A 11: 103,393,883 (GRCm39) S514F probably benign Het
Lrrc9 G T 12: 72,500,833 (GRCm39) L186F probably damaging Het
Metrn A G 17: 26,014,004 (GRCm39) V274A probably benign Het
Mettl25 A T 10: 105,659,040 (GRCm39) F414L possibly damaging Het
Mixl1 A G 1: 180,524,267 (GRCm39) V104A probably damaging Het
Myo9b T A 8: 71,800,986 (GRCm39) M1047K probably damaging Het
Nbea G A 3: 55,726,736 (GRCm39) A2081V probably benign Het
Ndufs1 A T 1: 63,189,171 (GRCm39) D551E possibly damaging Het
Nectin3 T C 16: 46,284,484 (GRCm39) T67A possibly damaging Het
Nme8 C T 13: 19,835,130 (GRCm39) V519I probably benign Het
Npat G T 9: 53,482,429 (GRCm39) G1379V probably benign Het
Obscn T A 11: 58,952,460 (GRCm39) T3870S probably benign Het
Or1e20-ps1 T A 11: 73,324,680 (GRCm39) H124L unknown Het
Or4g7 T C 2: 111,309,579 (GRCm39) V150A possibly damaging Het
Or5g23 T C 2: 85,439,093 (GRCm39) R54G possibly damaging Het
Or5k14 T C 16: 58,692,599 (GRCm39) M305V probably benign Het
Or7h8 T A 9: 20,123,747 (GRCm39) M34K possibly damaging Het
Or8b46 A G 9: 38,450,706 (GRCm39) N172D probably damaging Het
Pcnx1 C T 12: 81,965,593 (GRCm39) R59* probably null Het
Pdzd2 G A 15: 12,373,592 (GRCm39) S2181L probably benign Het
Phldb1 T C 9: 44,622,458 (GRCm39) E65G probably damaging Het
Ppif C T 14: 25,698,750 (GRCm39) T157M probably damaging Het
Ppp3ca T A 3: 136,637,986 (GRCm39) probably null Het
Proser1 T A 3: 53,379,509 (GRCm39) probably null Het
Reg3d T A 6: 78,353,062 (GRCm39) K174* probably null Het
Rubcn A T 16: 32,677,320 (GRCm39) L55Q probably damaging Het
Sec14l3 T C 11: 4,016,198 (GRCm39) L39P probably damaging Het
Ska3 A G 14: 58,063,559 (GRCm39) I4T probably damaging Het
Slc30a10 A G 1: 185,196,351 (GRCm39) I338V possibly damaging Het
Slc35g1 C G 19: 38,391,277 (GRCm39) S186R probably damaging Het
Slc35g1 T A 19: 38,391,279 (GRCm39) L187H probably damaging Het
Tbc1d5 T C 17: 51,049,114 (GRCm39) I659V probably benign Het
Tbl3 G T 17: 24,919,890 (GRCm39) D751E probably benign Het
Tdrd3 T A 14: 87,723,702 (GRCm39) D311E possibly damaging Het
Tenm4 T C 7: 96,503,935 (GRCm39) F1335S probably benign Het
Tm2d1 A T 4: 98,263,260 (GRCm39) C83S probably damaging Het
Tnfrsf22 A T 7: 143,192,110 (GRCm39) V192D unknown Het
Trpm6 A G 19: 18,789,154 (GRCm39) T575A probably damaging Het
Uri1 T C 7: 37,681,098 (GRCm39) D102G possibly damaging Het
Vmn2r1 T A 3: 64,010,471 (GRCm39) C570S probably damaging Het
Vps13a C T 19: 16,618,151 (GRCm39) V2906I probably damaging Het
Zfp472 T C 17: 33,196,977 (GRCm39) Y351H possibly damaging Het
Zfp874a G T 13: 67,591,353 (GRCm39) Y110* probably null Het
Zfp986 T A 4: 145,625,875 (GRCm39) N178K probably benign Het
Other mutations in Parp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Parp8 APN 13 117,063,859 (GRCm39) missense probably damaging 1.00
IGL01346:Parp8 APN 13 117,031,600 (GRCm39) missense possibly damaging 0.72
IGL01793:Parp8 APN 13 117,047,415 (GRCm39) missense probably damaging 1.00
IGL01926:Parp8 APN 13 116,998,838 (GRCm39) splice site probably benign
IGL01958:Parp8 APN 13 117,013,108 (GRCm39) missense probably benign 0.14
IGL02131:Parp8 APN 13 117,047,409 (GRCm39) missense probably benign 0.08
IGL02398:Parp8 APN 13 117,047,399 (GRCm39) critical splice donor site probably null
IGL02496:Parp8 APN 13 116,998,838 (GRCm39) splice site probably benign
IGL03135:Parp8 APN 13 117,047,478 (GRCm39) missense probably benign 0.41
IGL03143:Parp8 APN 13 117,047,497 (GRCm39) splice site probably benign
IGL03201:Parp8 APN 13 116,999,605 (GRCm39) splice site probably benign
blondi UTSW 13 117,029,577 (GRCm39) missense possibly damaging 0.77
Heidi UTSW 13 116,998,740 (GRCm39) splice site probably null
R0362:Parp8 UTSW 13 117,061,504 (GRCm39) nonsense probably null
R0699:Parp8 UTSW 13 117,059,120 (GRCm39) missense probably benign 0.01
R1445:Parp8 UTSW 13 117,161,886 (GRCm39) splice site probably null
R1676:Parp8 UTSW 13 117,014,064 (GRCm39) missense probably damaging 0.99
R1977:Parp8 UTSW 13 117,047,449 (GRCm39) missense probably damaging 0.96
R2019:Parp8 UTSW 13 117,004,968 (GRCm39) splice site probably benign
R2049:Parp8 UTSW 13 117,031,422 (GRCm39) missense probably benign 0.20
R2142:Parp8 UTSW 13 117,031,422 (GRCm39) missense probably benign 0.20
R2474:Parp8 UTSW 13 117,029,577 (GRCm39) missense possibly damaging 0.77
R2566:Parp8 UTSW 13 117,032,223 (GRCm39) missense possibly damaging 0.78
R3863:Parp8 UTSW 13 117,031,303 (GRCm39) missense probably benign 0.01
R4126:Parp8 UTSW 13 117,005,005 (GRCm39) missense possibly damaging 0.94
R4518:Parp8 UTSW 13 117,032,209 (GRCm39) missense possibly damaging 0.62
R4519:Parp8 UTSW 13 117,032,209 (GRCm39) missense possibly damaging 0.62
R4767:Parp8 UTSW 13 117,005,072 (GRCm39) missense probably damaging 0.99
R5355:Parp8 UTSW 13 116,998,740 (GRCm39) splice site probably null
R5633:Parp8 UTSW 13 117,013,116 (GRCm39) missense probably damaging 1.00
R5942:Parp8 UTSW 13 117,005,969 (GRCm39) missense probably benign 0.12
R5978:Parp8 UTSW 13 117,032,268 (GRCm39) missense probably benign 0.01
R6039:Parp8 UTSW 13 117,014,134 (GRCm39) missense probably damaging 1.00
R6039:Parp8 UTSW 13 117,014,134 (GRCm39) missense probably damaging 1.00
R6753:Parp8 UTSW 13 117,031,651 (GRCm39) missense possibly damaging 0.91
R7016:Parp8 UTSW 13 117,031,627 (GRCm39) missense probably damaging 1.00
R7139:Parp8 UTSW 13 117,161,802 (GRCm39) missense probably benign 0.21
R7305:Parp8 UTSW 13 117,031,461 (GRCm39) missense possibly damaging 0.95
R7314:Parp8 UTSW 13 117,004,996 (GRCm39) missense probably benign 0.01
R7360:Parp8 UTSW 13 117,032,307 (GRCm39) missense probably benign 0.02
R7526:Parp8 UTSW 13 117,031,341 (GRCm39) missense probably damaging 1.00
R8078:Parp8 UTSW 13 117,061,519 (GRCm39) missense probably damaging 1.00
R8372:Parp8 UTSW 13 116,991,786 (GRCm39) missense probably damaging 1.00
R9005:Parp8 UTSW 13 117,013,126 (GRCm39) missense probably benign
R9072:Parp8 UTSW 13 117,047,951 (GRCm39) missense probably damaging 1.00
R9073:Parp8 UTSW 13 117,047,951 (GRCm39) missense probably damaging 1.00
R9351:Parp8 UTSW 13 117,000,781 (GRCm39) missense probably damaging 0.99
R9441:Parp8 UTSW 13 117,029,562 (GRCm39) missense probably damaging 1.00
R9448:Parp8 UTSW 13 117,039,360 (GRCm39) nonsense probably null
R9470:Parp8 UTSW 13 117,031,292 (GRCm39) missense probably benign 0.02
R9562:Parp8 UTSW 13 117,029,631 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCAATGCCAGCAAACAGGAG -3'
(R):5'- GTCAAGTGGAGAACATTCTTTGTCTC -3'

Sequencing Primer
(F):5'- CAAACAGGAGGTCATTGTCTCCATG -3'
(R):5'- CTCATTCCAAAAGAGCTGATGGTGC -3'
Posted On 2020-06-30