Incidental Mutation 'R8108:Ska3'
ID 630758
Institutional Source Beutler Lab
Gene Symbol Ska3
Ensembl Gene ENSMUSG00000021965
Gene Name spindle and kinetochore associated complex subunit 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock # R8108 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 57806561-57826185 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57826102 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 4 (I4T)
Ref Sequence ENSEMBL: ENSMUSP00000022536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022536] [ENSMUST00000022538]
AlphaFold Q8C263
Predicted Effect probably damaging
Transcript: ENSMUST00000022536
AA Change: I4T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022536
Gene: ENSMUSG00000021965
AA Change: I4T

DomainStartEndE-ValueType
PDB:4AJ5|Z 1 101 3e-46 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000022538
SMART Domains Protein: ENSMUSP00000022538
Gene: ENSMUSG00000021967

DomainStartEndE-ValueType
Pfam:MRP-63 13 101 9e-42 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the spindle and kinetochore-associated protein complex that regulates microtubule attachment to the kinetochores during mitosis. The encoded protein localizes to the outer kinetechore and may be required for normal chromosome segregation and cell division. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 T A 12: 84,017,361 H414Q probably benign Het
Actrt2 A T 4: 154,667,036 D214E probably benign Het
Ccdc7a T C 8: 128,980,153 T332A unknown Het
Chd9 C T 8: 90,933,224 H271Y unknown Het
Depdc5 T G 5: 32,945,049 D966E probably benign Het
Dolpp1 A G 2: 30,396,246 Y119C probably benign Het
Dscam G C 16: 96,643,879 D1537E probably benign Het
Dusp16 A G 6: 134,739,873 I157T probably benign Het
Dyrk2 T C 10: 118,859,829 D508G probably benign Het
Endov T C 11: 119,507,411 V334A probably benign Het
Ep400 A T 5: 110,687,883 V1956E unknown Het
Erich3 A T 3: 154,720,115 Y83F possibly damaging Het
Fbrsl1 T C 5: 110,378,379 probably null Het
Gm1110 T C 9: 26,920,661 I65V probably damaging Het
Gm28374 A G 19: 6,082,200 V19A Het
Gm436 A T 4: 144,670,669 N164K probably benign Het
Gpr107 C A 2: 31,184,869 H336Q probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grm1 C A 10: 10,720,132 R584L probably benign Het
Gse1 T C 8: 120,229,810 S347P unknown Het
Ier3ip1 T A 18: 76,940,525 I69K possibly damaging Het
Impact T G 18: 12,984,331 L154V probably benign Het
Katnb1 T C 8: 95,093,945 F141S possibly damaging Het
Kifap3 T A 1: 163,797,362 N162K probably damaging Het
Klhl5 A G 5: 65,148,587 probably null Het
Klre1 A G 6: 129,584,222 D182G probably benign Het
Krt42 T A 11: 100,266,957 Y227F probably benign Het
Lhcgr T A 17: 88,742,050 K683* probably null Het
Lrrc37a G A 11: 103,503,057 S514F probably benign Het
Lrrc9 G T 12: 72,454,059 L186F probably damaging Het
Metrn A G 17: 25,795,030 V274A probably benign Het
Mettl25 A T 10: 105,823,179 F414L possibly damaging Het
Mixl1 A G 1: 180,696,702 V104A probably damaging Het
Myo9b T A 8: 71,348,342 M1047K probably damaging Het
Nbea G A 3: 55,819,315 A2081V probably benign Het
Ndufs1 A T 1: 63,150,012 D551E possibly damaging Het
Nectin3 T C 16: 46,464,121 T67A possibly damaging Het
Nme8 C T 13: 19,650,960 V519I probably benign Het
Npat G T 9: 53,571,129 G1379V probably benign Het
Obscn T A 11: 59,061,634 T3870S probably benign Het
Olfr1000 T C 2: 85,608,749 R54G possibly damaging Het
Olfr1288 T C 2: 111,479,234 V150A possibly damaging Het
Olfr177 T C 16: 58,872,236 M305V probably benign Het
Olfr379-ps1 T A 11: 73,433,854 H124L unknown Het
Olfr871 T A 9: 20,212,451 M34K possibly damaging Het
Olfr910 A G 9: 38,539,410 N172D probably damaging Het
Parp8 A T 13: 116,867,073 Y769* probably null Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phldb1 T C 9: 44,711,161 E65G probably damaging Het
Ppif C T 14: 25,698,326 T157M probably damaging Het
Ppp3ca T A 3: 136,932,225 probably null Het
Proser1 T A 3: 53,472,088 probably null Het
Reg3d T A 6: 78,376,079 K174* probably null Het
Rubcn A T 16: 32,856,950 L55Q probably damaging Het
Sec14l3 T C 11: 4,066,198 L39P probably damaging Het
Slc30a10 A G 1: 185,464,154 I338V possibly damaging Het
Slc35g1 C G 19: 38,402,829 S186R probably damaging Het
Slc35g1 T A 19: 38,402,831 L187H probably damaging Het
Spata5 T C 3: 37,431,782 S218P probably benign Het
Tbc1d5 T C 17: 50,742,086 I659V probably benign Het
Tbl3 G T 17: 24,700,916 D751E probably benign Het
Tdrd3 T A 14: 87,486,266 D311E possibly damaging Het
Tenm4 T C 7: 96,854,728 F1335S probably benign Het
Tm2d1 A T 4: 98,375,023 C83S probably damaging Het
Tnfrsf22 A T 7: 143,638,373 V192D unknown Het
Trpm6 A G 19: 18,811,790 T575A probably damaging Het
Uri1 T C 7: 37,981,673 D102G possibly damaging Het
Vmn2r1 T A 3: 64,103,050 C570S probably damaging Het
Vps13a C T 19: 16,640,787 V2906I probably damaging Het
Zfp472 T C 17: 32,978,003 Y351H possibly damaging Het
Zfp874a G T 13: 67,443,234 Y110* probably null Het
Zfp986 T A 4: 145,899,305 N178K probably benign Het
Other mutations in Ska3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Ska3 APN 14 57822124 missense possibly damaging 0.95
IGL01969:Ska3 APN 14 57811662 missense probably benign 0.00
IGL02539:Ska3 APN 14 57820511 missense possibly damaging 0.86
IGL02665:Ska3 APN 14 57822072 missense probably damaging 1.00
R1276:Ska3 UTSW 14 57820269 missense probably damaging 1.00
R3737:Ska3 UTSW 14 57811596 missense probably benign 0.00
R3738:Ska3 UTSW 14 57811596 missense probably benign 0.00
R3771:Ska3 UTSW 14 57810077 missense probably benign 0.06
R3772:Ska3 UTSW 14 57810077 missense probably benign 0.06
R3773:Ska3 UTSW 14 57810077 missense probably benign 0.06
R5269:Ska3 UTSW 14 57822116 missense possibly damaging 0.87
R6088:Ska3 UTSW 14 57816694 missense probably benign 0.01
R6320:Ska3 UTSW 14 57816691 missense probably benign 0.04
R7792:Ska3 UTSW 14 57810055 missense probably damaging 0.97
R8362:Ska3 UTSW 14 57816648 missense probably benign 0.27
R8976:Ska3 UTSW 14 57820394 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCCATCACAGATCAGCTACGC -3'
(R):5'- CTACACTGCAGGATATGGGG -3'

Sequencing Primer
(F):5'- AGATCAGCTACGCCCCTTG -3'
(R):5'- ACCTCGCGTACCAACCGG -3'
Posted On 2020-06-30