Incidental Mutation 'R8108:Tdrd3'
ID 630759
Institutional Source Beutler Lab
Gene Symbol Tdrd3
Ensembl Gene ENSMUSG00000022019
Gene Name tudor domain containing 3
Synonyms 4732418C03Rik
MMRRC Submission 067537-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.429) question?
Stock # R8108 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 87654075-87782940 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87723702 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 311 (D311E)
Ref Sequence ENSEMBL: ENSMUSP00000129019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168275] [ENSMUST00000169504] [ENSMUST00000170865]
AlphaFold Q91W18
PDB Structure Solution structure of the Tudor domain of Tudor domain containing protein 3 from mouse [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168275
AA Change: D311E

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129019
Gene: ENSMUSG00000022019
AA Change: D311E

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169504
AA Change: D311E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131542
Gene: ENSMUSG00000022019
AA Change: D311E

DomainStartEndE-ValueType
DUF1767 6 88 4.85e-24 SMART
low complexity region 269 280 N/A INTRINSIC
UBA 288 325 1.67e-7 SMART
low complexity region 338 348 N/A INTRINSIC
low complexity region 446 460 N/A INTRINSIC
TUDOR 646 705 1.07e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170865
AA Change: D305E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126189
Gene: ENSMUSG00000022019
AA Change: D305E

DomainStartEndE-ValueType
DUF1767 3 82 1.36e-18 SMART
low complexity region 263 274 N/A INTRINSIC
UBA 282 319 1.67e-7 SMART
low complexity region 332 342 N/A INTRINSIC
low complexity region 440 454 N/A INTRINSIC
TUDOR 640 699 1.07e-7 SMART
Meta Mutation Damage Score 0.1895 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 99% (72/73)
MGI Phenotype PHENOTYPE: Homozygous mice for a hypomorphic allele show increased genomic instability, and increased c-Myc/Igh translocation and R loop formation in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 A T 4: 144,397,239 (GRCm39) N164K probably benign Het
Acot1 T A 12: 84,064,135 (GRCm39) H414Q probably benign Het
Actrt2 A T 4: 154,751,493 (GRCm39) D214E probably benign Het
Afg2a T C 3: 37,485,931 (GRCm39) S218P probably benign Het
Ccdc7a T C 8: 129,706,634 (GRCm39) T332A unknown Het
Chd9 C T 8: 91,659,852 (GRCm39) H271Y unknown Het
Depdc5 T G 5: 33,102,393 (GRCm39) D966E probably benign Het
Dolpp1 A G 2: 30,286,258 (GRCm39) Y119C probably benign Het
Dscam G C 16: 96,445,079 (GRCm39) D1537E probably benign Het
Dusp16 A G 6: 134,716,836 (GRCm39) I157T probably benign Het
Dyrk2 T C 10: 118,695,734 (GRCm39) D508G probably benign Het
Endov T C 11: 119,398,237 (GRCm39) V334A probably benign Het
Ep400 A T 5: 110,835,749 (GRCm39) V1956E unknown Het
Erich3 A T 3: 154,425,752 (GRCm39) Y83F possibly damaging Het
Fbrsl1 T C 5: 110,526,245 (GRCm39) probably null Het
Gm1110 T C 9: 26,831,957 (GRCm39) I65V probably damaging Het
Gm28374 A G 19: 6,132,230 (GRCm39) V19A Het
Gpr107 C A 2: 31,074,881 (GRCm39) H336Q probably damaging Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Grm1 C A 10: 10,595,876 (GRCm39) R584L probably benign Het
Gse1 T C 8: 120,956,549 (GRCm39) S347P unknown Het
Ier3ip1 T A 18: 77,028,221 (GRCm39) I69K possibly damaging Het
Impact T G 18: 13,117,388 (GRCm39) L154V probably benign Het
Katnb1 T C 8: 95,820,573 (GRCm39) F141S possibly damaging Het
Kifap3 T A 1: 163,624,931 (GRCm39) N162K probably damaging Het
Klhl5 A G 5: 65,305,930 (GRCm39) probably null Het
Klre1 A G 6: 129,561,185 (GRCm39) D182G probably benign Het
Krt42 T A 11: 100,157,783 (GRCm39) Y227F probably benign Het
Lhcgr T A 17: 89,049,478 (GRCm39) K683* probably null Het
Lrrc37a G A 11: 103,393,883 (GRCm39) S514F probably benign Het
Lrrc9 G T 12: 72,500,833 (GRCm39) L186F probably damaging Het
Metrn A G 17: 26,014,004 (GRCm39) V274A probably benign Het
Mettl25 A T 10: 105,659,040 (GRCm39) F414L possibly damaging Het
Mixl1 A G 1: 180,524,267 (GRCm39) V104A probably damaging Het
Myo9b T A 8: 71,800,986 (GRCm39) M1047K probably damaging Het
Nbea G A 3: 55,726,736 (GRCm39) A2081V probably benign Het
Ndufs1 A T 1: 63,189,171 (GRCm39) D551E possibly damaging Het
Nectin3 T C 16: 46,284,484 (GRCm39) T67A possibly damaging Het
Nme8 C T 13: 19,835,130 (GRCm39) V519I probably benign Het
Npat G T 9: 53,482,429 (GRCm39) G1379V probably benign Het
Obscn T A 11: 58,952,460 (GRCm39) T3870S probably benign Het
Or1e20-ps1 T A 11: 73,324,680 (GRCm39) H124L unknown Het
Or4g7 T C 2: 111,309,579 (GRCm39) V150A possibly damaging Het
Or5g23 T C 2: 85,439,093 (GRCm39) R54G possibly damaging Het
Or5k14 T C 16: 58,692,599 (GRCm39) M305V probably benign Het
Or7h8 T A 9: 20,123,747 (GRCm39) M34K possibly damaging Het
Or8b46 A G 9: 38,450,706 (GRCm39) N172D probably damaging Het
Parp8 A T 13: 117,003,609 (GRCm39) Y769* probably null Het
Pcnx1 C T 12: 81,965,593 (GRCm39) R59* probably null Het
Pdzd2 G A 15: 12,373,592 (GRCm39) S2181L probably benign Het
Phldb1 T C 9: 44,622,458 (GRCm39) E65G probably damaging Het
Ppif C T 14: 25,698,750 (GRCm39) T157M probably damaging Het
Ppp3ca T A 3: 136,637,986 (GRCm39) probably null Het
Proser1 T A 3: 53,379,509 (GRCm39) probably null Het
Reg3d T A 6: 78,353,062 (GRCm39) K174* probably null Het
Rubcn A T 16: 32,677,320 (GRCm39) L55Q probably damaging Het
Sec14l3 T C 11: 4,016,198 (GRCm39) L39P probably damaging Het
Ska3 A G 14: 58,063,559 (GRCm39) I4T probably damaging Het
Slc30a10 A G 1: 185,196,351 (GRCm39) I338V possibly damaging Het
Slc35g1 C G 19: 38,391,277 (GRCm39) S186R probably damaging Het
Slc35g1 T A 19: 38,391,279 (GRCm39) L187H probably damaging Het
Tbc1d5 T C 17: 51,049,114 (GRCm39) I659V probably benign Het
Tbl3 G T 17: 24,919,890 (GRCm39) D751E probably benign Het
Tenm4 T C 7: 96,503,935 (GRCm39) F1335S probably benign Het
Tm2d1 A T 4: 98,263,260 (GRCm39) C83S probably damaging Het
Tnfrsf22 A T 7: 143,192,110 (GRCm39) V192D unknown Het
Trpm6 A G 19: 18,789,154 (GRCm39) T575A probably damaging Het
Uri1 T C 7: 37,681,098 (GRCm39) D102G possibly damaging Het
Vmn2r1 T A 3: 64,010,471 (GRCm39) C570S probably damaging Het
Vps13a C T 19: 16,618,151 (GRCm39) V2906I probably damaging Het
Zfp472 T C 17: 33,196,977 (GRCm39) Y351H possibly damaging Het
Zfp874a G T 13: 67,591,353 (GRCm39) Y110* probably null Het
Zfp986 T A 4: 145,625,875 (GRCm39) N178K probably benign Het
Other mutations in Tdrd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Tdrd3 APN 14 87,709,618 (GRCm39) missense probably damaging 1.00
IGL01339:Tdrd3 APN 14 87,718,230 (GRCm39) missense possibly damaging 0.75
IGL01565:Tdrd3 APN 14 87,709,668 (GRCm39) missense probably benign 0.01
IGL02505:Tdrd3 APN 14 87,749,118 (GRCm39) missense probably damaging 1.00
R0121:Tdrd3 UTSW 14 87,776,915 (GRCm39) missense probably damaging 1.00
R0550:Tdrd3 UTSW 14 87,723,656 (GRCm39) missense probably damaging 1.00
R0648:Tdrd3 UTSW 14 87,709,618 (GRCm39) missense probably damaging 1.00
R1080:Tdrd3 UTSW 14 87,743,834 (GRCm39) missense probably benign 0.00
R1099:Tdrd3 UTSW 14 87,724,675 (GRCm39) missense probably damaging 1.00
R1126:Tdrd3 UTSW 14 87,718,210 (GRCm39) missense probably damaging 1.00
R1370:Tdrd3 UTSW 14 87,695,490 (GRCm39) intron probably benign
R1592:Tdrd3 UTSW 14 87,743,322 (GRCm39) missense probably damaging 1.00
R1881:Tdrd3 UTSW 14 87,723,783 (GRCm39) splice site probably null
R2096:Tdrd3 UTSW 14 87,743,788 (GRCm39) nonsense probably null
R2162:Tdrd3 UTSW 14 87,718,221 (GRCm39) missense probably damaging 0.98
R3833:Tdrd3 UTSW 14 87,718,221 (GRCm39) missense probably damaging 0.98
R3947:Tdrd3 UTSW 14 87,744,035 (GRCm39) missense probably damaging 1.00
R4421:Tdrd3 UTSW 14 87,723,719 (GRCm39) missense probably damaging 1.00
R4783:Tdrd3 UTSW 14 87,709,537 (GRCm39) missense probably damaging 1.00
R4957:Tdrd3 UTSW 14 87,743,223 (GRCm39) missense probably benign 0.06
R5212:Tdrd3 UTSW 14 87,743,651 (GRCm39) missense probably damaging 0.98
R5291:Tdrd3 UTSW 14 87,743,234 (GRCm39) missense probably benign 0.21
R5318:Tdrd3 UTSW 14 87,714,899 (GRCm39) critical splice donor site probably null
R5383:Tdrd3 UTSW 14 87,718,227 (GRCm39) nonsense probably null
R5718:Tdrd3 UTSW 14 87,743,876 (GRCm39) missense probably benign 0.05
R6240:Tdrd3 UTSW 14 87,743,322 (GRCm39) missense probably damaging 1.00
R6292:Tdrd3 UTSW 14 87,743,690 (GRCm39) missense probably benign
R6532:Tdrd3 UTSW 14 87,743,252 (GRCm39) missense probably damaging 0.98
R6850:Tdrd3 UTSW 14 87,695,515 (GRCm39) intron probably benign
R6958:Tdrd3 UTSW 14 87,694,532 (GRCm39) missense probably damaging 1.00
R7224:Tdrd3 UTSW 14 87,714,839 (GRCm39) missense probably damaging 1.00
R7240:Tdrd3 UTSW 14 87,696,239 (GRCm39) missense probably benign 0.06
R7565:Tdrd3 UTSW 14 87,744,029 (GRCm39) nonsense probably null
R7818:Tdrd3 UTSW 14 87,709,636 (GRCm39) missense probably damaging 1.00
R7861:Tdrd3 UTSW 14 87,709,590 (GRCm39) missense probably damaging 1.00
R8206:Tdrd3 UTSW 14 87,749,214 (GRCm39) missense probably benign 0.11
R8383:Tdrd3 UTSW 14 87,743,744 (GRCm39) missense probably benign 0.26
R8786:Tdrd3 UTSW 14 87,709,637 (GRCm39) nonsense probably null
R8985:Tdrd3 UTSW 14 87,743,597 (GRCm39) missense possibly damaging 0.69
R9081:Tdrd3 UTSW 14 87,743,717 (GRCm39) missense probably benign 0.00
R9520:Tdrd3 UTSW 14 87,724,696 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAAGTCAGAATGTTGTGTCAG -3'
(R):5'- TGTATGTCTCCAAGCCTCCAG -3'

Sequencing Primer
(F):5'- CAGTGTGACAGTTTCGCTATAGC -3'
(R):5'- TCCAGCTTCTAAGAACCAGTGTTAC -3'
Posted On 2020-06-30