Incidental Mutation 'R8108:Metrn'
ID 630766
Institutional Source Beutler Lab
Gene Symbol Metrn
Ensembl Gene ENSMUSG00000002274
Gene Name meteorin, glial cell differentiation regulator
Synonyms 1810034B16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.326) question?
Stock # R8108 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 25794571-25797136 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25795030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 274 (V274A)
Ref Sequence ENSEMBL: ENSMUSP00000127275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002344] [ENSMUST00000072735] [ENSMUST00000095500] [ENSMUST00000165838]
AlphaFold Q8C1Q4
Predicted Effect probably benign
Transcript: ENSMUST00000002344
AA Change: V274A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000002344
Gene: ENSMUSG00000002274
AA Change: V274A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072735
SMART Domains Protein: ENSMUSP00000072518
Gene: ENSMUSG00000057411

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
SCOP:d1f3la_ 65 141 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095500
SMART Domains Protein: ENSMUSP00000093155
Gene: ENSMUSG00000071202

DomainStartEndE-ValueType
Pfam:DUF4472 63 190 5.5e-23 PFAM
coiled coil region 364 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165838
AA Change: V274A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127275
Gene: ENSMUSG00000002274
AA Change: V274A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Meteorin regulates glial cell differentiation and promotes the formation of axonal networks during neurogenesis (Nishino et al., 2004 [PubMed 15085178]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 T A 12: 84,017,361 H414Q probably benign Het
Actrt2 A T 4: 154,667,036 D214E probably benign Het
Ccdc7a T C 8: 128,980,153 T332A unknown Het
Chd9 C T 8: 90,933,224 H271Y unknown Het
Depdc5 T G 5: 32,945,049 D966E probably benign Het
Dolpp1 A G 2: 30,396,246 Y119C probably benign Het
Dscam G C 16: 96,643,879 D1537E probably benign Het
Dusp16 A G 6: 134,739,873 I157T probably benign Het
Dyrk2 T C 10: 118,859,829 D508G probably benign Het
Endov T C 11: 119,507,411 V334A probably benign Het
Ep400 A T 5: 110,687,883 V1956E unknown Het
Erich3 A T 3: 154,720,115 Y83F possibly damaging Het
Fbrsl1 T C 5: 110,378,379 probably null Het
Gm1110 T C 9: 26,920,661 I65V probably damaging Het
Gm28374 A G 19: 6,082,200 V19A Het
Gm436 A T 4: 144,670,669 N164K probably benign Het
Gpr107 C A 2: 31,184,869 H336Q probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grm1 C A 10: 10,720,132 R584L probably benign Het
Gse1 T C 8: 120,229,810 S347P unknown Het
Ier3ip1 T A 18: 76,940,525 I69K possibly damaging Het
Impact T G 18: 12,984,331 L154V probably benign Het
Katnb1 T C 8: 95,093,945 F141S possibly damaging Het
Kifap3 T A 1: 163,797,362 N162K probably damaging Het
Klhl5 A G 5: 65,148,587 probably null Het
Klre1 A G 6: 129,584,222 D182G probably benign Het
Krt42 T A 11: 100,266,957 Y227F probably benign Het
Lhcgr T A 17: 88,742,050 K683* probably null Het
Lrrc37a G A 11: 103,503,057 S514F probably benign Het
Lrrc9 G T 12: 72,454,059 L186F probably damaging Het
Mettl25 A T 10: 105,823,179 F414L possibly damaging Het
Mixl1 A G 1: 180,696,702 V104A probably damaging Het
Myo9b T A 8: 71,348,342 M1047K probably damaging Het
Nbea G A 3: 55,819,315 A2081V probably benign Het
Ndufs1 A T 1: 63,150,012 D551E possibly damaging Het
Nectin3 T C 16: 46,464,121 T67A possibly damaging Het
Nme8 C T 13: 19,650,960 V519I probably benign Het
Npat G T 9: 53,571,129 G1379V probably benign Het
Obscn T A 11: 59,061,634 T3870S probably benign Het
Olfr1000 T C 2: 85,608,749 R54G possibly damaging Het
Olfr1288 T C 2: 111,479,234 V150A possibly damaging Het
Olfr177 T C 16: 58,872,236 M305V probably benign Het
Olfr379-ps1 T A 11: 73,433,854 H124L unknown Het
Olfr871 T A 9: 20,212,451 M34K possibly damaging Het
Olfr910 A G 9: 38,539,410 N172D probably damaging Het
Parp8 A T 13: 116,867,073 Y769* probably null Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phldb1 T C 9: 44,711,161 E65G probably damaging Het
Ppif C T 14: 25,698,326 T157M probably damaging Het
Ppp3ca T A 3: 136,932,225 probably null Het
Proser1 T A 3: 53,472,088 probably null Het
Reg3d T A 6: 78,376,079 K174* probably null Het
Rubcn A T 16: 32,856,950 L55Q probably damaging Het
Sec14l3 T C 11: 4,066,198 L39P probably damaging Het
Ska3 A G 14: 57,826,102 I4T probably damaging Het
Slc30a10 A G 1: 185,464,154 I338V possibly damaging Het
Slc35g1 C G 19: 38,402,829 S186R probably damaging Het
Slc35g1 T A 19: 38,402,831 L187H probably damaging Het
Spata5 T C 3: 37,431,782 S218P probably benign Het
Tbc1d5 T C 17: 50,742,086 I659V probably benign Het
Tbl3 G T 17: 24,700,916 D751E probably benign Het
Tdrd3 T A 14: 87,486,266 D311E possibly damaging Het
Tenm4 T C 7: 96,854,728 F1335S probably benign Het
Tm2d1 A T 4: 98,375,023 C83S probably damaging Het
Tnfrsf22 A T 7: 143,638,373 V192D unknown Het
Trpm6 A G 19: 18,811,790 T575A probably damaging Het
Uri1 T C 7: 37,981,673 D102G possibly damaging Het
Vmn2r1 T A 3: 64,103,050 C570S probably damaging Het
Vps13a C T 19: 16,640,787 V2906I probably damaging Het
Zfp472 T C 17: 32,978,003 Y351H possibly damaging Het
Zfp874a G T 13: 67,443,234 Y110* probably null Het
Zfp986 T A 4: 145,899,305 N178K probably benign Het
Other mutations in Metrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0008:Metrn UTSW 17 25796505 missense possibly damaging 0.94
R0280:Metrn UTSW 17 25795135 missense probably benign 0.08
R0729:Metrn UTSW 17 25796228 splice site probably benign
R1523:Metrn UTSW 17 25794977 makesense probably null
R2119:Metrn UTSW 17 25795223 missense probably benign 0.03
R2146:Metrn UTSW 17 25796627 missense probably damaging 0.99
R4036:Metrn UTSW 17 25795010 missense probably benign
R4037:Metrn UTSW 17 25795010 missense probably benign
R4038:Metrn UTSW 17 25795010 missense probably benign
R4230:Metrn UTSW 17 25796941 unclassified probably benign
R5074:Metrn UTSW 17 25796639 missense probably damaging 1.00
R5259:Metrn UTSW 17 25796540 missense probably damaging 1.00
R5686:Metrn UTSW 17 25795217 missense probably damaging 1.00
R5744:Metrn UTSW 17 25795237 missense probably damaging 1.00
R7707:Metrn UTSW 17 25795410 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CAGAAGACCATGACTACAGTGG -3'
(R):5'- CACTGCCACTGTTCAAGGAAG -3'

Sequencing Primer
(F):5'- AGTATTCTACCAGCTCACTGTGGG -3'
(R):5'- CCACTGTTCAAGGAAGGGAGCTC -3'
Posted On 2020-06-30