Incidental Mutation 'R8108:Lhcgr'
ID 630769
Institutional Source Beutler Lab
Gene Symbol Lhcgr
Ensembl Gene ENSMUSG00000024107
Gene Name luteinizing hormone/choriogonadotropin receptor
Synonyms Lhr, LH-R, Gpcr19-rs1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8108 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 88741549-88791976 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 88742050 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 683 (K683*)
Ref Sequence ENSEMBL: ENSMUSP00000024916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024916]
AlphaFold P30730
Predicted Effect probably null
Transcript: ENSMUST00000024916
AA Change: K683*
SMART Domains Protein: ENSMUSP00000024916
Gene: ENSMUSG00000024107
AA Change: K683*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
LRRNT 33 66 4.4e0 SMART
Pfam:LRR_5 155 273 2.9e-5 PFAM
Pfam:7tm_1 380 627 1.2e-29 PFAM
Meta Mutation Damage Score 0.9590 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for both luteinizing hormone and choriogonadotropin. This receptor belongs to the G-protein coupled receptor 1 family, and its activity is mediated by G proteins which activate adenylate cyclase. Mutations in this gene result in disorders of male secondary sexual character development, including familial male precocious puberty, also known as testotoxicosis, hypogonadotropic hypogonadism, Leydig cell adenoma with precocious puberty, and male pseudohermaphtoditism with Leydig cell hypoplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are infertile and have abnormal hormone levels. Males have undescended testes, immature external and accessory sex organs and blocked spermatogenesis. Females have small ovaries and uteri, immature follicles and do not cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 T A 12: 84,017,361 H414Q probably benign Het
Actrt2 A T 4: 154,667,036 D214E probably benign Het
Ccdc7a T C 8: 128,980,153 T332A unknown Het
Chd9 C T 8: 90,933,224 H271Y unknown Het
Depdc5 T G 5: 32,945,049 D966E probably benign Het
Dolpp1 A G 2: 30,396,246 Y119C probably benign Het
Dscam G C 16: 96,643,879 D1537E probably benign Het
Dusp16 A G 6: 134,739,873 I157T probably benign Het
Dyrk2 T C 10: 118,859,829 D508G probably benign Het
Endov T C 11: 119,507,411 V334A probably benign Het
Ep400 A T 5: 110,687,883 V1956E unknown Het
Erich3 A T 3: 154,720,115 Y83F possibly damaging Het
Fbrsl1 T C 5: 110,378,379 probably null Het
Gm1110 T C 9: 26,920,661 I65V probably damaging Het
Gm28374 A G 19: 6,082,200 V19A Het
Gm436 A T 4: 144,670,669 N164K probably benign Het
Gpr107 C A 2: 31,184,869 H336Q probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grm1 C A 10: 10,720,132 R584L probably benign Het
Gse1 T C 8: 120,229,810 S347P unknown Het
Ier3ip1 T A 18: 76,940,525 I69K possibly damaging Het
Impact T G 18: 12,984,331 L154V probably benign Het
Katnb1 T C 8: 95,093,945 F141S possibly damaging Het
Kifap3 T A 1: 163,797,362 N162K probably damaging Het
Klhl5 A G 5: 65,148,587 probably null Het
Klre1 A G 6: 129,584,222 D182G probably benign Het
Krt42 T A 11: 100,266,957 Y227F probably benign Het
Lrrc37a G A 11: 103,503,057 S514F probably benign Het
Lrrc9 G T 12: 72,454,059 L186F probably damaging Het
Metrn A G 17: 25,795,030 V274A probably benign Het
Mettl25 A T 10: 105,823,179 F414L possibly damaging Het
Mixl1 A G 1: 180,696,702 V104A probably damaging Het
Myo9b T A 8: 71,348,342 M1047K probably damaging Het
Nbea G A 3: 55,819,315 A2081V probably benign Het
Ndufs1 A T 1: 63,150,012 D551E possibly damaging Het
Nectin3 T C 16: 46,464,121 T67A possibly damaging Het
Nme8 C T 13: 19,650,960 V519I probably benign Het
Npat G T 9: 53,571,129 G1379V probably benign Het
Obscn T A 11: 59,061,634 T3870S probably benign Het
Olfr1000 T C 2: 85,608,749 R54G possibly damaging Het
Olfr1288 T C 2: 111,479,234 V150A possibly damaging Het
Olfr177 T C 16: 58,872,236 M305V probably benign Het
Olfr379-ps1 T A 11: 73,433,854 H124L unknown Het
Olfr871 T A 9: 20,212,451 M34K possibly damaging Het
Olfr910 A G 9: 38,539,410 N172D probably damaging Het
Parp8 A T 13: 116,867,073 Y769* probably null Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phldb1 T C 9: 44,711,161 E65G probably damaging Het
Ppif C T 14: 25,698,326 T157M probably damaging Het
Ppp3ca T A 3: 136,932,225 probably null Het
Proser1 T A 3: 53,472,088 probably null Het
Reg3d T A 6: 78,376,079 K174* probably null Het
Rubcn A T 16: 32,856,950 L55Q probably damaging Het
Sec14l3 T C 11: 4,066,198 L39P probably damaging Het
Ska3 A G 14: 57,826,102 I4T probably damaging Het
Slc30a10 A G 1: 185,464,154 I338V possibly damaging Het
Slc35g1 C G 19: 38,402,829 S186R probably damaging Het
Slc35g1 T A 19: 38,402,831 L187H probably damaging Het
Spata5 T C 3: 37,431,782 S218P probably benign Het
Tbc1d5 T C 17: 50,742,086 I659V probably benign Het
Tbl3 G T 17: 24,700,916 D751E probably benign Het
Tdrd3 T A 14: 87,486,266 D311E possibly damaging Het
Tenm4 T C 7: 96,854,728 F1335S probably benign Het
Tm2d1 A T 4: 98,375,023 C83S probably damaging Het
Tnfrsf22 A T 7: 143,638,373 V192D unknown Het
Trpm6 A G 19: 18,811,790 T575A probably damaging Het
Uri1 T C 7: 37,981,673 D102G possibly damaging Het
Vmn2r1 T A 3: 64,103,050 C570S probably damaging Het
Vps13a C T 19: 16,640,787 V2906I probably damaging Het
Zfp472 T C 17: 32,978,003 Y351H possibly damaging Het
Zfp874a G T 13: 67,443,234 Y110* probably null Het
Zfp986 T A 4: 145,899,305 N178K probably benign Het
Other mutations in Lhcgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Lhcgr APN 17 88742446 missense probably benign
IGL00661:Lhcgr APN 17 88750118 missense probably benign
IGL00840:Lhcgr APN 17 88753736 splice site probably benign
IGL01434:Lhcgr APN 17 88742437 missense probably damaging 1.00
IGL01489:Lhcgr APN 17 88764973 splice site probably benign
IGL02077:Lhcgr APN 17 88750130 missense probably benign 0.06
IGL02533:Lhcgr APN 17 88742410 missense probably benign 0.00
IGL02948:Lhcgr APN 17 88742622 missense probably damaging 1.00
capybara UTSW 17 88742586 nonsense probably null
coro UTSW 17 88742249 nonsense probably null
nutria UTSW 17 88742373 missense probably damaging 1.00
R0101:Lhcgr UTSW 17 88765170 missense probably damaging 1.00
R0101:Lhcgr UTSW 17 88765170 missense probably damaging 1.00
R0556:Lhcgr UTSW 17 88772063 missense probably damaging 0.99
R1824:Lhcgr UTSW 17 88750157 missense probably benign 0.00
R1846:Lhcgr UTSW 17 88765147 critical splice donor site probably null
R1852:Lhcgr UTSW 17 88765176 missense probably damaging 0.99
R2352:Lhcgr UTSW 17 88742299 missense possibly damaging 0.52
R3147:Lhcgr UTSW 17 88758343 missense probably damaging 0.96
R3756:Lhcgr UTSW 17 88753856 missense possibly damaging 0.77
R4180:Lhcgr UTSW 17 88742283 missense probably damaging 1.00
R4540:Lhcgr UTSW 17 88755608 missense probably benign
R4688:Lhcgr UTSW 17 88765152 missense probably damaging 0.99
R4717:Lhcgr UTSW 17 88742467 missense probably benign 0.00
R4723:Lhcgr UTSW 17 88742602 missense probably benign 0.09
R4776:Lhcgr UTSW 17 88742697 missense probably damaging 1.00
R4903:Lhcgr UTSW 17 88742361 missense probably damaging 1.00
R5195:Lhcgr UTSW 17 88742946 missense probably damaging 1.00
R5231:Lhcgr UTSW 17 88755611 missense probably damaging 1.00
R5361:Lhcgr UTSW 17 88742853 missense probably damaging 1.00
R5683:Lhcgr UTSW 17 88772019 missense probably benign 0.00
R5758:Lhcgr UTSW 17 88742548 missense probably damaging 0.99
R5929:Lhcgr UTSW 17 88743008 nonsense probably null
R5987:Lhcgr UTSW 17 88755578 missense probably damaging 1.00
R6268:Lhcgr UTSW 17 88742704 missense probably damaging 1.00
R6477:Lhcgr UTSW 17 88742373 missense probably damaging 1.00
R6610:Lhcgr UTSW 17 88769879 missense possibly damaging 0.93
R7234:Lhcgr UTSW 17 88791931 missense possibly damaging 0.96
R7282:Lhcgr UTSW 17 88758383 missense probably benign
R7320:Lhcgr UTSW 17 88742078 missense probably benign
R7398:Lhcgr UTSW 17 88772046 missense probably benign 0.03
R7710:Lhcgr UTSW 17 88742782 missense probably damaging 1.00
R8034:Lhcgr UTSW 17 88742356 missense probably damaging 1.00
R8150:Lhcgr UTSW 17 88742249 nonsense probably null
R8151:Lhcgr UTSW 17 88742249 nonsense probably null
R8236:Lhcgr UTSW 17 88742586 nonsense probably null
R8901:Lhcgr UTSW 17 88755602 missense probably damaging 1.00
R8916:Lhcgr UTSW 17 88753742 critical splice donor site probably null
U24488:Lhcgr UTSW 17 88772085 critical splice acceptor site probably null
X0028:Lhcgr UTSW 17 88742722 missense probably damaging 1.00
Z1176:Lhcgr UTSW 17 88742270 missense probably damaging 1.00
Z1177:Lhcgr UTSW 17 88753905 missense probably benign 0.00
Z1177:Lhcgr UTSW 17 88764981 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTTTCAATTCACCTGAAGTGC -3'
(R):5'- GTCACCAACTCAAAAGTTCTGC -3'

Sequencing Primer
(F):5'- TCAATTCACCTGAAGTGCTTAAAG -3'
(R):5'- AACTCAAAAGTTCTGCTGGTCC -3'
Posted On 2020-06-30