Incidental Mutation 'R8108:Gm28374'
ID 630772
Institutional Source Beutler Lab
Gene Symbol Gm28374
Ensembl Gene ENSMUSG00000100621
Gene Name predicted gene 28374
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock # R8108 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 6076945-6082256 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6082200 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 19 (V19A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025704] [ENSMUST00000025707] [ENSMUST00000143303] [ENSMUST00000149347] [ENSMUST00000159832] [ENSMUST00000159859] [ENSMUST00000160448] [ENSMUST00000160590] [ENSMUST00000160712] [ENSMUST00000160977] [ENSMUST00000161548]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025704
SMART Domains Protein: ENSMUSP00000025704
Gene: ENSMUSG00000024791

DomainStartEndE-ValueType
low complexity region 17 34 N/A INTRINSIC
Pfam:Sororin 88 228 4.1e-31 PFAM
low complexity region 251 264 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000025707
SMART Domains Protein: ENSMUSP00000025707
Gene: ENSMUSG00000024792

DomainStartEndE-ValueType
RING 53 100 1.14e-1 SMART
low complexity region 149 160 N/A INTRINSIC
low complexity region 184 193 N/A INTRINSIC
transmembrane domain 265 287 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143303
SMART Domains Protein: ENSMUSP00000121339
Gene: ENSMUSG00000047733

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
transmembrane domain 82 99 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149347
SMART Domains Protein: ENSMUSP00000116436
Gene: ENSMUSG00000047733

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159832
SMART Domains Protein: ENSMUSP00000123994
Gene: ENSMUSG00000024797

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2e-10 PFAM
Pfam:DUF2450 62 250 1.9e-14 PFAM
Pfam:Vps51 63 149 8.3e-27 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Sec5 101 275 1.6e-19 PFAM
low complexity region 276 292 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159859
SMART Domains Protein: ENSMUSP00000124857
Gene: ENSMUSG00000024792

DomainStartEndE-ValueType
RING 53 100 1.14e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160448
Predicted Effect probably benign
Transcript: ENSMUST00000160590
SMART Domains Protein: ENSMUSP00000123857
Gene: ENSMUSG00000024797

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:Vps51 63 121 2.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160712
SMART Domains Protein: ENSMUSP00000125085
Gene: ENSMUSG00000024792

DomainStartEndE-ValueType
RING 53 100 1.14e-1 SMART
low complexity region 149 160 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000160977
SMART Domains Protein: ENSMUSP00000125176
Gene: ENSMUSG00000024792

DomainStartEndE-ValueType
RING 53 100 1.14e-1 SMART
low complexity region 149 160 N/A INTRINSIC
low complexity region 184 193 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000161548
SMART Domains Protein: ENSMUSP00000125459
Gene: ENSMUSG00000024792

DomainStartEndE-ValueType
RING 53 100 1.14e-1 SMART
low complexity region 149 160 N/A INTRINSIC
low complexity region 184 193 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 99.0%
  • 20x: 97.3%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot1 T A 12: 84,017,361 H414Q probably benign Het
Actrt2 A T 4: 154,667,036 D214E probably benign Het
Ccdc7a T C 8: 128,980,153 T332A unknown Het
Chd9 C T 8: 90,933,224 H271Y unknown Het
Depdc5 T G 5: 32,945,049 D966E probably benign Het
Dolpp1 A G 2: 30,396,246 Y119C probably benign Het
Dscam G C 16: 96,643,879 D1537E probably benign Het
Dusp16 A G 6: 134,739,873 I157T probably benign Het
Dyrk2 T C 10: 118,859,829 D508G probably benign Het
Endov T C 11: 119,507,411 V334A probably benign Het
Ep400 A T 5: 110,687,883 V1956E unknown Het
Erich3 A T 3: 154,720,115 Y83F possibly damaging Het
Fbrsl1 T C 5: 110,378,379 probably null Het
Gm1110 T C 9: 26,920,661 I65V probably damaging Het
Gm436 A T 4: 144,670,669 N164K probably benign Het
Gpr107 C A 2: 31,184,869 H336Q probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C Het
Grm1 C A 10: 10,720,132 R584L probably benign Het
Gse1 T C 8: 120,229,810 S347P unknown Het
Ier3ip1 T A 18: 76,940,525 I69K possibly damaging Het
Impact T G 18: 12,984,331 L154V probably benign Het
Katnb1 T C 8: 95,093,945 F141S possibly damaging Het
Kifap3 T A 1: 163,797,362 N162K probably damaging Het
Klhl5 A G 5: 65,148,587 probably null Het
Klre1 A G 6: 129,584,222 D182G probably benign Het
Krt42 T A 11: 100,266,957 Y227F probably benign Het
Lhcgr T A 17: 88,742,050 K683* probably null Het
Lrrc37a G A 11: 103,503,057 S514F probably benign Het
Lrrc9 G T 12: 72,454,059 L186F probably damaging Het
Metrn A G 17: 25,795,030 V274A probably benign Het
Mettl25 A T 10: 105,823,179 F414L possibly damaging Het
Mixl1 A G 1: 180,696,702 V104A probably damaging Het
Myo9b T A 8: 71,348,342 M1047K probably damaging Het
Nbea G A 3: 55,819,315 A2081V probably benign Het
Ndufs1 A T 1: 63,150,012 D551E possibly damaging Het
Nectin3 T C 16: 46,464,121 T67A possibly damaging Het
Nme8 C T 13: 19,650,960 V519I probably benign Het
Npat G T 9: 53,571,129 G1379V probably benign Het
Obscn T A 11: 59,061,634 T3870S probably benign Het
Olfr1000 T C 2: 85,608,749 R54G possibly damaging Het
Olfr1288 T C 2: 111,479,234 V150A possibly damaging Het
Olfr177 T C 16: 58,872,236 M305V probably benign Het
Olfr379-ps1 T A 11: 73,433,854 H124L unknown Het
Olfr871 T A 9: 20,212,451 M34K possibly damaging Het
Olfr910 A G 9: 38,539,410 N172D probably damaging Het
Parp8 A T 13: 116,867,073 Y769* probably null Het
Pcnx C T 12: 81,918,819 R59* probably null Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phldb1 T C 9: 44,711,161 E65G probably damaging Het
Ppif C T 14: 25,698,326 T157M probably damaging Het
Ppp3ca T A 3: 136,932,225 probably null Het
Proser1 T A 3: 53,472,088 probably null Het
Reg3d T A 6: 78,376,079 K174* probably null Het
Rubcn A T 16: 32,856,950 L55Q probably damaging Het
Sec14l3 T C 11: 4,066,198 L39P probably damaging Het
Ska3 A G 14: 57,826,102 I4T probably damaging Het
Slc30a10 A G 1: 185,464,154 I338V possibly damaging Het
Slc35g1 C G 19: 38,402,829 S186R probably damaging Het
Slc35g1 T A 19: 38,402,831 L187H probably damaging Het
Spata5 T C 3: 37,431,782 S218P probably benign Het
Tbc1d5 T C 17: 50,742,086 I659V probably benign Het
Tbl3 G T 17: 24,700,916 D751E probably benign Het
Tdrd3 T A 14: 87,486,266 D311E possibly damaging Het
Tenm4 T C 7: 96,854,728 F1335S probably benign Het
Tm2d1 A T 4: 98,375,023 C83S probably damaging Het
Tnfrsf22 A T 7: 143,638,373 V192D unknown Het
Trpm6 A G 19: 18,811,790 T575A probably damaging Het
Uri1 T C 7: 37,981,673 D102G possibly damaging Het
Vmn2r1 T A 3: 64,103,050 C570S probably damaging Het
Vps13a C T 19: 16,640,787 V2906I probably damaging Het
Zfp472 T C 17: 32,978,003 Y351H possibly damaging Het
Zfp874a G T 13: 67,443,234 Y110* probably null Het
Zfp986 T A 4: 145,899,305 N178K probably benign Het
Predicted Primers PCR Primer
(F):5'- AGGTGGCATAAAGGACCTCC -3'
(R):5'- AGACTTCTCTGATTGGTCCAGC -3'

Sequencing Primer
(F):5'- AGGACCTCCTGCCCTCC -3'
(R):5'- AATGGTAAGTGGTGGCCTCCATC -3'
Posted On 2020-06-30