Incidental Mutation 'R8110:Fmo9'
ID 630780
Institutional Source Beutler Lab
Gene Symbol Fmo9
Ensembl Gene ENSMUSG00000026560
Gene Name flavin containing monooxygenase 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8110 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 166662055-166681845 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 166663526 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 461 (M461T)
Ref Sequence ENSEMBL: ENSMUSP00000027843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027843] [ENSMUST00000148677]
AlphaFold Q8C116
Predicted Effect probably benign
Transcript: ENSMUST00000027843
AA Change: M461T

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000027843
Gene: ENSMUSG00000026560
AA Change: M461T

DomainStartEndE-ValueType
Pfam:FMO-like 3 535 1.2e-252 PFAM
Pfam:Pyr_redox_2 4 262 2.9e-12 PFAM
Pfam:Pyr_redox_3 7 221 2.3e-14 PFAM
Pfam:NAD_binding_8 8 83 1.2e-6 PFAM
Pfam:K_oxygenase 77 334 8.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148677
AA Change: M410T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000114750
Gene: ENSMUSG00000026560
AA Change: M410T

DomainStartEndE-ValueType
Pfam:FMO-like 1 484 1.6e-222 PFAM
Pfam:Pyr_redox_3 3 170 1.2e-12 PFAM
Pfam:K_oxygenase 28 283 6.2e-11 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.1%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G T 11: 23,576,764 T696N probably benign Het
Ankrd45 T C 1: 161,151,319 probably null Het
Appl1 C A 14: 26,927,794 G592* probably null Het
Arfgef2 T A 2: 166,878,544 M1501K probably benign Het
Calcrl C T 2: 84,339,339 A333T probably damaging Het
Cd200r3 T A 16: 44,951,472 I33N probably benign Het
Ceacam15 A G 7: 16,673,409 L61P probably benign Het
Cfap69 T A 5: 5,582,515 H827L possibly damaging Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Cyp2u1 G A 3: 131,293,654 T426I probably damaging Het
Eefsec A C 6: 88,376,330 I119S probably damaging Het
Fem1b T C 9: 62,796,268 N570S probably damaging Het
Fryl A G 5: 73,133,277 Y95H probably benign Het
Fsip2 T C 2: 82,958,673 I346T probably benign Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gabbr1 G C 17: 37,048,583 S150T probably benign Het
Galnt9 G T 5: 110,615,473 W448L probably damaging Het
Gcnt2 G T 13: 40,917,722 probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm17727 T C 9: 35,778,033 *84W probably null Het
Gm8882 C T 6: 132,361,568 G229D unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd4 A G 5: 121,332,949 Y2633C possibly damaging Het
Hsd11b2 A G 8: 105,522,634 I214V probably damaging Het
Hspa12a T A 19: 58,821,013 E217V possibly damaging Het
Itih2 A G 2: 10,097,137 F845L probably damaging Het
Kcnn3 T A 3: 89,661,233 L606H probably damaging Het
Krt6b G A 15: 101,680,142 R28C probably damaging Het
Lama2 T A 10: 26,990,870 D2876V probably damaging Het
Lmbrd2 T C 15: 9,175,192 S397P probably damaging Het
Lmf2 C T 15: 89,352,358 probably null Het
Lrp2 A G 2: 69,506,453 I1325T probably benign Het
Ltbp2 A T 12: 84,803,902 C879* probably null Het
Map3k1 A G 13: 111,755,313 V1136A probably damaging Het
Mettl3 G T 14: 52,300,252 H84N probably benign Het
Mia2 A G 12: 59,109,087 probably null Het
Mlip G T 9: 77,239,579 T92K probably damaging Het
Nalcn T A 14: 123,464,701 Y466F probably benign Het
Nav2 T A 7: 49,551,950 L235* probably null Het
Nbn T C 4: 15,981,588 V560A probably benign Het
Ncln A T 10: 81,493,153 Y144N possibly damaging Het
Nfe2l2 A C 2: 75,679,421 D18E probably benign Het
Olfr102 A G 17: 37,313,713 F224L probably benign Het
Olfr1131 T C 2: 87,628,607 I48T possibly damaging Het
Olfr356 T C 2: 36,937,709 C197R possibly damaging Het
Olfr432 G A 1: 174,050,525 A51T probably benign Het
Otop3 A T 11: 115,339,395 M33L probably benign Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phf14 T C 6: 11,953,423 I387T possibly damaging Het
Prdm9 T A 17: 15,554,698 N318Y probably damaging Het
Proca1 A G 11: 78,204,911 D123G probably damaging Het
Prune2 G A 19: 17,120,719 G1196S probably benign Het
Psd3 T A 8: 68,121,056 S158C probably damaging Het
Rps18 A G 17: 33,955,136 V15A probably benign Het
Sharpin C A 15: 76,347,765 R271L possibly damaging Het
Smad5 C A 13: 56,723,888 Q99K probably damaging Het
Sox5 T C 6: 144,116,474 M151V possibly damaging Het
Sphkap A T 1: 83,278,771 F419Y possibly damaging Het
Tbx20 T A 9: 24,725,525 Y422F probably damaging Het
Tcirg1 A C 19: 3,899,099 F397V probably damaging Het
Tex36 G A 7: 133,595,283 S35F possibly damaging Het
Tsen54 G T 11: 115,814,934 A26S unknown Het
Usp50 T A 2: 126,780,330 probably null Het
Vmn2r5 A T 3: 64,491,288 F757I probably benign Het
Zbbx T C 3: 75,155,442 T3A possibly damaging Het
Zfp28 T A 7: 6,389,829 M168K probably benign Het
Zfp568 G T 7: 30,023,126 G499W probably damaging Het
Zfp7 C G 15: 76,890,931 P391R possibly damaging Het
Other mutations in Fmo9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Fmo9 APN 1 166680145 splice site probably null
IGL01796:Fmo9 APN 1 166663335 missense probably benign 0.31
IGL03005:Fmo9 APN 1 166674519 missense probably benign 0.02
IGL03115:Fmo9 APN 1 166677651 missense probably damaging 1.00
IGL03163:Fmo9 APN 1 166674450 missense possibly damaging 0.77
R0089:Fmo9 UTSW 1 166667309 missense probably benign 0.05
R0570:Fmo9 UTSW 1 166674462 missense probably null 0.00
R1520:Fmo9 UTSW 1 166667455 missense probably benign 0.19
R1779:Fmo9 UTSW 1 166663299 missense probably benign 0.18
R1783:Fmo9 UTSW 1 166673648 missense probably benign 0.01
R2858:Fmo9 UTSW 1 166673667 missense probably damaging 1.00
R2859:Fmo9 UTSW 1 166673667 missense probably damaging 1.00
R3851:Fmo9 UTSW 1 166663367 missense probably benign 0.00
R3924:Fmo9 UTSW 1 166664652 missense probably benign 0.03
R4470:Fmo9 UTSW 1 166680230 missense probably damaging 1.00
R4728:Fmo9 UTSW 1 166663311 missense possibly damaging 0.82
R5538:Fmo9 UTSW 1 166673629 missense probably benign 0.01
R5650:Fmo9 UTSW 1 166663446 missense probably damaging 1.00
R5820:Fmo9 UTSW 1 166664601 missense possibly damaging 0.67
R6163:Fmo9 UTSW 1 166667393 missense probably benign
R6229:Fmo9 UTSW 1 166677557 missense possibly damaging 0.64
R6243:Fmo9 UTSW 1 166667369 missense probably benign 0.45
R6375:Fmo9 UTSW 1 166664595 critical splice donor site probably null
R7144:Fmo9 UTSW 1 166677620 missense probably benign 0.40
R7236:Fmo9 UTSW 1 166676571 missense probably damaging 1.00
R7316:Fmo9 UTSW 1 166663646 missense probably benign 0.21
R7341:Fmo9 UTSW 1 166676546 missense probably damaging 1.00
R7382:Fmo9 UTSW 1 166663660 splice site probably null
R7589:Fmo9 UTSW 1 166674428 missense possibly damaging 0.61
R7679:Fmo9 UTSW 1 166667489 missense probably benign 0.01
R8500:Fmo9 UTSW 1 166674470 missense probably damaging 1.00
R9098:Fmo9 UTSW 1 166664630 missense possibly damaging 0.48
R9301:Fmo9 UTSW 1 166667225 missense probably damaging 1.00
R9400:Fmo9 UTSW 1 166677674 missense probably benign 0.09
R9401:Fmo9 UTSW 1 166677620 missense probably damaging 0.99
Z1088:Fmo9 UTSW 1 166673545 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AACTTGGAACCAGAAATGCCAG -3'
(R):5'- AGACATAGTTAAAGCTCCTGCC -3'

Sequencing Primer
(F):5'- TGCCAGGCCAAATAGTGC -3'
(R):5'- ATAGTTAAAGCTCCTGCCCAGTACTG -3'
Posted On 2020-06-30