Incidental Mutation 'R8110:Olfr356'
ID 630783
Institutional Source Beutler Lab
Gene Symbol Olfr356
Ensembl Gene ENSMUSG00000070943
Gene Name olfactory receptor 356
Synonyms GA_x6K02T2NLDC-33631647-33632594, MOR134-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R8110 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 36937121-36938068 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36937709 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 197 (C197R)
Ref Sequence ENSEMBL: ENSMUSP00000092631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095021]
AlphaFold Q8VFP5
Predicted Effect possibly damaging
Transcript: ENSMUST00000095021
AA Change: C197R

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092631
Gene: ENSMUSG00000070943
AA Change: C197R

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.1e-52 PFAM
Pfam:7tm_1 41 290 4.9e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G T 11: 23,576,764 T696N probably benign Het
Ankrd45 T C 1: 161,151,319 probably null Het
Appl1 C A 14: 26,927,794 G592* probably null Het
Arfgef2 T A 2: 166,878,544 M1501K probably benign Het
Calcrl C T 2: 84,339,339 A333T probably damaging Het
Cd200r3 T A 16: 44,951,472 I33N probably benign Het
Ceacam15 A G 7: 16,673,409 L61P probably benign Het
Cfap69 T A 5: 5,582,515 H827L possibly damaging Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Cyp2u1 G A 3: 131,293,654 T426I probably damaging Het
Eefsec A C 6: 88,376,330 I119S probably damaging Het
Fem1b T C 9: 62,796,268 N570S probably damaging Het
Fmo9 A G 1: 166,663,526 M461T probably benign Het
Fryl A G 5: 73,133,277 Y95H probably benign Het
Fsip2 T C 2: 82,958,673 I346T probably benign Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gabbr1 G C 17: 37,048,583 S150T probably benign Het
Galnt9 G T 5: 110,615,473 W448L probably damaging Het
Gcnt2 G T 13: 40,917,722 probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm17727 T C 9: 35,778,033 *84W probably null Het
Gm8882 C T 6: 132,361,568 G229D unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd4 A G 5: 121,332,949 Y2633C possibly damaging Het
Hsd11b2 A G 8: 105,522,634 I214V probably damaging Het
Hspa12a T A 19: 58,821,013 E217V possibly damaging Het
Itih2 A G 2: 10,097,137 F845L probably damaging Het
Kcnn3 T A 3: 89,661,233 L606H probably damaging Het
Krt6b G A 15: 101,680,142 R28C probably damaging Het
Lama2 T A 10: 26,990,870 D2876V probably damaging Het
Lmbrd2 T C 15: 9,175,192 S397P probably damaging Het
Lmf2 C T 15: 89,352,358 probably null Het
Lrp2 A G 2: 69,506,453 I1325T probably benign Het
Ltbp2 A T 12: 84,803,902 C879* probably null Het
Map3k1 A G 13: 111,755,313 V1136A probably damaging Het
Mettl3 G T 14: 52,300,252 H84N probably benign Het
Mia2 A G 12: 59,109,087 probably null Het
Mlip G T 9: 77,239,579 T92K probably damaging Het
Nalcn T A 14: 123,464,701 Y466F probably benign Het
Nav2 T A 7: 49,551,950 L235* probably null Het
Nbn T C 4: 15,981,588 V560A probably benign Het
Ncln A T 10: 81,493,153 Y144N possibly damaging Het
Nfe2l2 A C 2: 75,679,421 D18E probably benign Het
Olfr102 A G 17: 37,313,713 F224L probably benign Het
Olfr1131 T C 2: 87,628,607 I48T possibly damaging Het
Olfr432 G A 1: 174,050,525 A51T probably benign Het
Otop3 A T 11: 115,339,395 M33L probably benign Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phf14 T C 6: 11,953,423 I387T possibly damaging Het
Prdm9 T A 17: 15,554,698 N318Y probably damaging Het
Proca1 A G 11: 78,204,911 D123G probably damaging Het
Prune2 G A 19: 17,120,719 G1196S probably benign Het
Psd3 T A 8: 68,121,056 S158C probably damaging Het
Rps18 A G 17: 33,955,136 V15A probably benign Het
Sharpin C A 15: 76,347,765 R271L possibly damaging Het
Smad5 C A 13: 56,723,888 Q99K probably damaging Het
Sox5 T C 6: 144,116,474 M151V possibly damaging Het
Sphkap A T 1: 83,278,771 F419Y possibly damaging Het
Tbx20 T A 9: 24,725,525 Y422F probably damaging Het
Tcirg1 A C 19: 3,899,099 F397V probably damaging Het
Tex36 G A 7: 133,595,283 S35F possibly damaging Het
Tsen54 G T 11: 115,814,934 A26S unknown Het
Usp50 T A 2: 126,780,330 probably null Het
Vmn2r5 A T 3: 64,491,288 F757I probably benign Het
Zbbx T C 3: 75,155,442 T3A possibly damaging Het
Zfp28 T A 7: 6,389,829 M168K probably benign Het
Zfp568 G T 7: 30,023,126 G499W probably damaging Het
Zfp7 C G 15: 76,890,931 P391R possibly damaging Het
Other mutations in Olfr356
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02209:Olfr356 APN 2 36937505 missense probably damaging 1.00
IGL02457:Olfr356 APN 2 36937748 missense probably damaging 0.99
IGL02933:Olfr356 APN 2 36937298 missense probably damaging 1.00
IGL03304:Olfr356 APN 2 36937548 missense probably damaging 0.99
IGL03350:Olfr356 APN 2 36937583 missense probably damaging 1.00
IGL03050:Olfr356 UTSW 2 36937623 missense probably damaging 0.99
R0124:Olfr356 UTSW 2 36937256 missense possibly damaging 0.80
R1447:Olfr356 UTSW 2 36937776 missense possibly damaging 0.54
R1591:Olfr356 UTSW 2 36937978 missense probably damaging 1.00
R1651:Olfr356 UTSW 2 36937323 missense probably damaging 0.99
R1689:Olfr356 UTSW 2 36937977 missense probably damaging 1.00
R1876:Olfr356 UTSW 2 36937763 missense possibly damaging 0.80
R2132:Olfr356 UTSW 2 36937692 missense probably benign 0.00
R2308:Olfr356 UTSW 2 36937300 nonsense probably null
R3004:Olfr356 UTSW 2 36937209 missense possibly damaging 0.64
R4180:Olfr356 UTSW 2 36937230 missense probably damaging 0.98
R4445:Olfr356 UTSW 2 36937551 missense probably damaging 0.99
R5096:Olfr356 UTSW 2 36937803 missense possibly damaging 0.64
R5971:Olfr356 UTSW 2 36937229 missense probably benign 0.01
R5988:Olfr356 UTSW 2 36937224 missense probably damaging 1.00
R6138:Olfr356 UTSW 2 36937229 missense probably benign 0.01
R6544:Olfr356 UTSW 2 36937527 missense possibly damaging 0.68
R7206:Olfr356 UTSW 2 36937772 missense probably damaging 1.00
R7752:Olfr356 UTSW 2 36937618 missense probably damaging 0.98
R7854:Olfr356 UTSW 2 36938024 missense probably benign
R9088:Olfr356 UTSW 2 36937976 missense probably damaging 1.00
R9223:Olfr356 UTSW 2 36937899 missense probably damaging 1.00
U15987:Olfr356 UTSW 2 36937229 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACACCTTGGTCATGAGTCCC -3'
(R):5'- GCAGCGTATGGAATGAAATACACC -3'

Sequencing Primer
(F):5'- ACCTTGGTCATGAGTCCCAGATG -3'
(R):5'- GTATGGAATGAAATACACCCCAATAG -3'
Posted On 2020-06-30