Mutagenetix > Incidental Mutations

Incidental Mutation 'R8110:Nfe2l2'

630785

Institutional Source

Beutler Lab

Gene Symbol

Nfe2l2

Ensembl Gene

ENSMUSG00000015839

Gene Name

nuclear factor, erythroid derived 2, like 2

Synonyms

Nrf2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.803) question?

Stock #

R8110 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75675513-75704641 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 75679421 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 18 (D18E)

Ref Sequence

ENSEMBL: ENSMUSP00000099733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102672]

AlphaFold

Q60795

PDB Structure

Structural basis for the defects of human lung cancer somatic mutations in the repression activity of Keap1 on Nrf2 [X-RAY DIFFRACTION]
Crystal structure of the Keap1 protein in complexed with the N-terminal region of the Nrf2 transcription factor [X-RAY DIFFRACTION]
Crystal Structure of Keap1 in Complex with the N-terminal region of the Nrf2 transcription factor [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000102672
AA Change: D18E

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000099733
Gene: ENSMUSG00000015839
AA Change: D18E

Domain	Start	End	E-Value	Type
PDB:3WN7\|M	17	42	8e-10	PDB
low complexity region	43	68	N/A	INTRINSIC
BRLZ	487	551	6.46e-9	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 93.1%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: This gene encodes a transcription factor which is a member of a small family of basic leucine zipper (bZIP) proteins. The encoded transcription factor regulates genes which contain antioxidant response elements (ARE) in their promoters; many of these genes encode proteins involved in response to injury and inflammation which includes the production of free radicals. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to oxidative stress in a variety of organs and cells including brain, liver, erythrocytes, and spleen, abnormal tooth enamel, and abnormal response to various injuries, chemical treatments, and induced inflammatory diseases. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	G	T	11: 23,576,764	T696N	probably benign	Het
Ankrd45	T	C	1: 161,151,319		probably null	Het
Appl1	C	A	14: 26,927,794	G592*	probably null	Het
Arfgef2	T	A	2: 166,878,544	M1501K	probably benign	Het
Calcrl	C	T	2: 84,339,339	A333T	probably damaging	Het
Cd200r3	T	A	16: 44,951,472	I33N	probably benign	Het
Ceacam15	A	G	7: 16,673,409	L61P	probably benign	Het
Cfap69	T	A	5: 5,582,515	H827L	possibly damaging	Het
Csmd3	T	A	15: 47,644,270	E2780V	probably damaging	Het
Cyp2u1	G	A	3: 131,293,654	T426I	probably damaging	Het
Eefsec	A	C	6: 88,376,330	I119S	probably damaging	Het
Fem1b	T	C	9: 62,796,268	N570S	probably damaging	Het
Fmo9	A	G	1: 166,663,526	M461T	probably benign	Het
Fryl	A	G	5: 73,133,277	Y95H	probably benign	Het
Fsip2	T	C	2: 82,958,673	I346T	probably benign	Het
Fto	T	C	8: 91,485,190	F381S	probably damaging	Het
Gabbr1	G	C	17: 37,048,583	S150T	probably benign	Het
Galnt9	G	T	5: 110,615,473	W448L	probably damaging	Het
Gcnt2	G	T	13: 40,917,722		probably benign	Het
Gm10800	CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA	CAAGAAAACTGAAAATCA	2: 98,667,016		probably null	Het
Gm17727	T	C	9: 35,778,033	*84W	probably null	Het
Gm8882	C	T	6: 132,361,568	G229D	unknown	Het
Gmcl1	G	T	6: 86,721,426	A163E	probably damaging	Het
Hectd4	A	G	5: 121,332,949	Y2633C	possibly damaging	Het
Hsd11b2	A	G	8: 105,522,634	I214V	probably damaging	Het
Hspa12a	T	A	19: 58,821,013	E217V	possibly damaging	Het
Itih2	A	G	2: 10,097,137	F845L	probably damaging	Het
Kcnn3	T	A	3: 89,661,233	L606H	probably damaging	Het
Krt6b	G	A	15: 101,680,142	R28C	probably damaging	Het
Lama2	T	A	10: 26,990,870	D2876V	probably damaging	Het
Lmbrd2	T	C	15: 9,175,192	S397P	probably damaging	Het
Lmf2	C	T	15: 89,352,358		probably null	Het
Lrp2	A	G	2: 69,506,453	I1325T	probably benign	Het
Ltbp2	A	T	12: 84,803,902	C879*	probably null	Het
Map3k1	A	G	13: 111,755,313	V1136A	probably damaging	Het
Mettl3	G	T	14: 52,300,252	H84N	probably benign	Het
Mia2	A	G	12: 59,109,087		probably null	Het
Mlip	G	T	9: 77,239,579	T92K	probably damaging	Het
Nalcn	T	A	14: 123,464,701	Y466F	probably benign	Het
Nav2	T	A	7: 49,551,950	L235*	probably null	Het
Nbn	T	C	4: 15,981,588	V560A	probably benign	Het
Ncln	A	T	10: 81,493,153	Y144N	possibly damaging	Het
Olfr102	A	G	17: 37,313,713	F224L	probably benign	Het
Olfr1131	T	C	2: 87,628,607	I48T	possibly damaging	Het
Olfr356	T	C	2: 36,937,709	C197R	possibly damaging	Het
Olfr432	G	A	1: 174,050,525	A51T	probably benign	Het
Otop3	A	T	11: 115,339,395	M33L	probably benign	Het
Pdzd2	G	A	15: 12,373,506	S2181L	probably benign	Het
Phf14	T	C	6: 11,953,423	I387T	possibly damaging	Het
Prdm9	T	A	17: 15,554,698	N318Y	probably damaging	Het
Proca1	A	G	11: 78,204,911	D123G	probably damaging	Het
Prune2	G	A	19: 17,120,719	G1196S	probably benign	Het
Psd3	T	A	8: 68,121,056	S158C	probably damaging	Het
Rps18	A	G	17: 33,955,136	V15A	probably benign	Het
Sharpin	C	A	15: 76,347,765	R271L	possibly damaging	Het
Smad5	C	A	13: 56,723,888	Q99K	probably damaging	Het
Sox5	T	C	6: 144,116,474	M151V	possibly damaging	Het
Sphkap	A	T	1: 83,278,771	F419Y	possibly damaging	Het
Tbx20	T	A	9: 24,725,525	Y422F	probably damaging	Het
Tcirg1	A	C	19: 3,899,099	F397V	probably damaging	Het
Tex36	G	A	7: 133,595,283	S35F	possibly damaging	Het
Tsen54	G	T	11: 115,814,934	A26S	unknown	Het
Usp50	T	A	2: 126,780,330		probably null	Het
Vmn2r5	A	T	3: 64,491,288	F757I	probably benign	Het
Zbbx	T	C	3: 75,155,442	T3A	possibly damaging	Het
Zfp28	T	A	7: 6,389,829	M168K	probably benign	Het
Zfp568	G	T	7: 30,023,126	G499W	probably damaging	Het
Zfp7	C	G	15: 76,890,931	P391R	possibly damaging	Het

Other mutations in Nfe2l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Nfe2l2	APN	2	75679413	missense	probably damaging	1.00
IGL00931:Nfe2l2	APN	2	75675998	missense	probably damaging	1.00
IGL02207:Nfe2l2	APN	2	75678525	missense	probably damaging	1.00
IGL03356:Nfe2l2	APN	2	75679200	missense	probably benign	0.00
Scarlett	UTSW	2	75679413	missense	probably damaging	1.00
R0582:Nfe2l2	UTSW	2	75676768	missense	probably damaging	1.00
R0782:Nfe2l2	UTSW	2	75676833	missense	probably benign	0.12
R1139:Nfe2l2	UTSW	2	75676886	missense	probably benign	0.00
R2237:Nfe2l2	UTSW	2	75676554	missense	probably benign	0.03
R2239:Nfe2l2	UTSW	2	75676554	missense	probably benign	0.03
R4365:Nfe2l2	UTSW	2	75679428	missense	probably damaging	1.00
R5240:Nfe2l2	UTSW	2	75676009	missense	possibly damaging	0.63
R5328:Nfe2l2	UTSW	2	75676856	missense	probably damaging	1.00
R5666:Nfe2l2	UTSW	2	75677118	missense	probably benign	0.01
R5670:Nfe2l2	UTSW	2	75677118	missense	probably benign	0.01
R6142:Nfe2l2	UTSW	2	75679417	missense	probably damaging	0.99
R6315:Nfe2l2	UTSW	2	75676819	missense	probably damaging	1.00
R6520:Nfe2l2	UTSW	2	75676568	missense	probably benign	0.00
R7621:Nfe2l2	UTSW	2	75679413	missense	probably damaging	1.00
Z1176:Nfe2l2	UTSW	2	75679164	missense	probably null	0.68
Z1177:Nfe2l2	UTSW	2	75676779	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GGCTGAATTGGGAGGAATTCTC -3'
(R):5'- CGAATGGGTAGCTAGATCTTGTTGC -3'

Sequencing Primer
(F):5'- CCTGTTTCTTCATCCAGTTGAAAC -3'
(R):5'- AGCTAGATCTTGTTGCTTTTAGC -3'

Posted On

2020-06-30