Incidental Mutation 'R8110:Zbbx'
ID630792
Institutional Source Beutler Lab
Gene Symbol Zbbx
Ensembl Gene ENSMUSG00000034151
Gene Namezinc finger, B-box domain containing
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R8110 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location75037907-75165034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75155442 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 3 (T3A)
Ref Sequence ENSEMBL: ENSMUSP00000122459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124618]
Predicted Effect possibly damaging
Transcript: ENSMUST00000124618
AA Change: T3A

PolyPhen 2 Score 0.581 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122459
Gene: ENSMUSG00000034151
AA Change: T3A

DomainStartEndE-ValueType
coiled coil region 23 60 N/A INTRINSIC
Pfam:zf-B_box 128 174 1.3e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.1%
Validation Efficiency 57% (42/74)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G T 11: 23,576,764 T696N probably benign Het
Ankrd45 T C 1: 161,151,319 probably null Het
Appl1 C A 14: 26,927,794 G592* probably null Het
Arfgef2 T A 2: 166,878,544 M1501K probably benign Het
Calcrl C T 2: 84,339,339 A333T probably damaging Het
Cd200r3 T A 16: 44,951,472 I33N probably benign Het
Ceacam15 A G 7: 16,673,409 L61P probably benign Het
Cfap69 T A 5: 5,582,515 H827L possibly damaging Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Cyp2u1 G A 3: 131,293,654 T426I probably damaging Het
Eefsec A C 6: 88,376,330 I119S probably damaging Het
Fem1b T C 9: 62,796,268 N570S probably damaging Het
Fmo9 A G 1: 166,663,526 M461T probably benign Het
Fryl A G 5: 73,133,277 Y95H probably benign Het
Fsip2 T C 2: 82,958,673 I346T probably benign Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Fxyd2 G A 9: 45,408,375 probably null Het
Gabbr1 G C 17: 37,048,583 S150T probably benign Het
Galnt9 G T 5: 110,615,473 W448L probably damaging Het
Gcnt2 G T 13: 40,917,722 probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm17727 T C 9: 35,778,033 *84W probably null Het
Gm8882 C T 6: 132,361,568 G229D unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd4 A G 5: 121,332,949 Y2633C possibly damaging Het
Hsd11b2 A G 8: 105,522,634 I214V probably damaging Het
Hspa12a T A 19: 58,821,013 E217V possibly damaging Het
Itih2 A G 2: 10,097,137 F845L probably damaging Het
Kcnn3 T A 3: 89,661,233 L606H probably damaging Het
Krt6b G A 15: 101,680,142 R28C probably damaging Het
Lama2 T A 10: 26,990,870 D2876V probably damaging Het
Lmbrd2 T C 15: 9,175,192 S397P probably damaging Het
Lmf2 C T 15: 89,352,358 probably null Het
Lrp2 A G 2: 69,506,453 I1325T probably benign Het
Ltbp2 A T 12: 84,803,902 C879* probably null Het
Map3k1 A G 13: 111,755,313 V1136A probably damaging Het
Mettl3 G T 14: 52,300,252 H84N probably benign Het
Mia2 A G 12: 59,109,087 probably null Het
Mlip G T 9: 77,239,579 T92K probably damaging Het
Nalcn T A 14: 123,464,701 Y466F probably benign Het
Nav2 T A 7: 49,551,950 L235* probably null Het
Nbn T C 4: 15,981,588 V560A probably benign Het
Ncln A T 10: 81,493,153 Y144N possibly damaging Het
Nfe2l2 A C 2: 75,679,421 D18E probably benign Het
Olfr102 A G 17: 37,313,713 F224L probably benign Het
Olfr1131 T C 2: 87,628,607 I48T possibly damaging Het
Olfr356 T C 2: 36,937,709 C197R possibly damaging Het
Olfr432 G A 1: 174,050,525 A51T probably benign Het
Otop3 A T 11: 115,339,395 M33L probably benign Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phf14 T C 6: 11,953,423 I387T possibly damaging Het
Prdm9 T A 17: 15,554,698 N318Y probably damaging Het
Proca1 A G 11: 78,204,911 D123G probably damaging Het
Prune2 G A 19: 17,120,719 G1196S probably benign Het
Psd3 T A 8: 68,121,056 S158C probably damaging Het
Rps18 A G 17: 33,955,136 V15A probably benign Het
Sharpin C A 15: 76,347,765 R271L possibly damaging Het
Smad5 C A 13: 56,723,888 Q99K probably damaging Het
Sox5 T C 6: 144,116,474 M151V possibly damaging Het
Sphkap A T 1: 83,278,771 F419Y possibly damaging Het
Tbx20 T A 9: 24,725,525 Y422F probably damaging Het
Tcirg1 A C 19: 3,899,099 F397V probably damaging Het
Tex36 G A 7: 133,595,283 S35F possibly damaging Het
Tsen54 G T 11: 115,814,934 A26S unknown Het
Tubb5 G A 17: 35,838,275 probably benign Het
Usp50 T A 2: 126,780,330 probably null Het
Vmn2r5 A T 3: 64,491,288 F757I probably benign Het
Zfp28 T A 7: 6,389,829 M168K probably benign Het
Zfp568 G T 7: 30,023,126 G499W probably damaging Het
Zfp7 C G 15: 76,890,931 P391R possibly damaging Het
Other mutations in Zbbx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Zbbx APN 3 75061532 critical splice donor site probably null
IGL01328:Zbbx APN 3 75093075 nonsense probably null
IGL01340:Zbbx APN 3 75105650 missense possibly damaging 0.53
IGL01631:Zbbx APN 3 75078677 missense probably damaging 0.99
IGL01681:Zbbx APN 3 75052478 missense probably damaging 1.00
IGL02427:Zbbx APN 3 75139598 missense probably benign 0.04
IGL03077:Zbbx APN 3 75081846 missense possibly damaging 0.61
IGL03115:Zbbx APN 3 75078560 missense probably benign 0.03
IGL03162:Zbbx APN 3 75071623 splice site probably benign
Eland UTSW 3 75071712 missense probably benign 0.01
PIT4480001:Zbbx UTSW 3 75136487 missense probably damaging 1.00
PIT4495001:Zbbx UTSW 3 75061637 missense probably damaging 1.00
R0179:Zbbx UTSW 3 75085562 splice site probably benign
R0396:Zbbx UTSW 3 75078495 missense possibly damaging 0.81
R0523:Zbbx UTSW 3 75081858 missense probably benign 0.03
R0603:Zbbx UTSW 3 75078450 missense probably benign 0.05
R0745:Zbbx UTSW 3 75155427 missense probably damaging 1.00
R0747:Zbbx UTSW 3 75155427 missense probably damaging 1.00
R1208:Zbbx UTSW 3 75037992 missense possibly damaging 0.94
R1208:Zbbx UTSW 3 75037992 missense possibly damaging 0.94
R1371:Zbbx UTSW 3 75052477 missense possibly damaging 0.58
R1769:Zbbx UTSW 3 75083619 splice site probably benign
R1906:Zbbx UTSW 3 75071740 missense probably damaging 1.00
R2069:Zbbx UTSW 3 75078412 missense probably benign 0.01
R2165:Zbbx UTSW 3 75112107 missense probably damaging 0.99
R2174:Zbbx UTSW 3 75052414 missense possibly damaging 0.93
R2979:Zbbx UTSW 3 75078486 nonsense probably null
R3121:Zbbx UTSW 3 75081846 missense possibly damaging 0.88
R3755:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R3756:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R3816:Zbbx UTSW 3 75085495 missense probably benign 0.00
R4002:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4003:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4057:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4072:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4073:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4075:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4114:Zbbx UTSW 3 75139598 missense probably benign 0.04
R4784:Zbbx UTSW 3 75085041 missense probably benign 0.05
R4821:Zbbx UTSW 3 75081747 missense possibly damaging 0.68
R5008:Zbbx UTSW 3 75151448 missense possibly damaging 0.62
R5030:Zbbx UTSW 3 75083683 missense possibly damaging 0.83
R5388:Zbbx UTSW 3 75083670 missense probably damaging 0.98
R6398:Zbbx UTSW 3 75078565 missense probably damaging 0.96
R6462:Zbbx UTSW 3 75078659 missense probably benign 0.07
R6597:Zbbx UTSW 3 75136454 missense probably damaging 1.00
R6882:Zbbx UTSW 3 75071712 missense probably benign 0.01
R7084:Zbbx UTSW 3 75139546 missense possibly damaging 0.92
R7096:Zbbx UTSW 3 75081737 missense probably benign 0.03
R7102:Zbbx UTSW 3 75112094 missense probably benign 0.06
R7256:Zbbx UTSW 3 75039898 missense probably benign 0.02
R7537:Zbbx UTSW 3 75085519 missense probably damaging 1.00
R7836:Zbbx UTSW 3 75078474 missense possibly damaging 0.65
R7905:Zbbx UTSW 3 75085513 missense probably benign 0.23
R8367:Zbbx UTSW 3 75081727 critical splice donor site probably null
Z1177:Zbbx UTSW 3 75071783 critical splice acceptor site probably null
Z1177:Zbbx UTSW 3 75105684 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGACACTAATTGATCCTTTAGTCC -3'
(R):5'- GTGTCAGTCTTCAACACTGCAC -3'

Sequencing Primer
(F):5'- TGAAAGACCTTTAATTTGAAAACCAG -3'
(R):5'- CTGCTTTAACTTTGGGTTGA -3'
Posted On2020-06-30