Incidental Mutation 'R8110:Kcnn3'
ID630793
Institutional Source Beutler Lab
Gene Symbol Kcnn3
Ensembl Gene ENSMUSG00000000794
Gene Namepotassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Synonymssmall conductance calcium-activated potassium channel 3, SK3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.432) question?
Stock #R8110 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location89520164-89675132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89661233 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 606 (L606H)
Ref Sequence ENSEMBL: ENSMUSP00000000811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000811]
Predicted Effect probably damaging
Transcript: ENSMUST00000000811
AA Change: L606H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000811
Gene: ENSMUSG00000000794
AA Change: L606H

DomainStartEndE-ValueType
low complexity region 30 96 N/A INTRINSIC
low complexity region 139 154 N/A INTRINSIC
low complexity region 213 224 N/A INTRINSIC
Pfam:SK_channel 270 383 3.1e-51 PFAM
Pfam:Ion_trans_2 462 548 2.2e-14 PFAM
CaMBD 562 638 1.04e-49 SMART
low complexity region 684 690 N/A INTRINSIC
low complexity region 718 731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.1%
Validation Efficiency 57% (42/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for an insertion of a tetracycline-regulated gene switch display no overt phenotype when expression is abolished by doxycycline treatment; in contrast, untreated homozygotes show abnormal respiratory responses to hypoxia, impaired parturition, and pregnancy-related premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G T 11: 23,576,764 T696N probably benign Het
Ankrd45 T C 1: 161,151,319 probably null Het
Appl1 C A 14: 26,927,794 G592* probably null Het
Arfgef2 T A 2: 166,878,544 M1501K probably benign Het
Calcrl C T 2: 84,339,339 A333T probably damaging Het
Cd200r3 T A 16: 44,951,472 I33N probably benign Het
Ceacam15 A G 7: 16,673,409 L61P probably benign Het
Cfap69 T A 5: 5,582,515 H827L possibly damaging Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Cyp2u1 G A 3: 131,293,654 T426I probably damaging Het
Eefsec A C 6: 88,376,330 I119S probably damaging Het
Fem1b T C 9: 62,796,268 N570S probably damaging Het
Fmo9 A G 1: 166,663,526 M461T probably benign Het
Fryl A G 5: 73,133,277 Y95H probably benign Het
Fsip2 T C 2: 82,958,673 I346T probably benign Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Fxyd2 G A 9: 45,408,375 probably null Het
Gabbr1 G C 17: 37,048,583 S150T probably benign Het
Galnt9 G T 5: 110,615,473 W448L probably damaging Het
Gcnt2 G T 13: 40,917,722 probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm17727 T C 9: 35,778,033 *84W probably null Het
Gm8882 C T 6: 132,361,568 G229D unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd4 A G 5: 121,332,949 Y2633C possibly damaging Het
Hsd11b2 A G 8: 105,522,634 I214V probably damaging Het
Hspa12a T A 19: 58,821,013 E217V possibly damaging Het
Itih2 A G 2: 10,097,137 F845L probably damaging Het
Krt6b G A 15: 101,680,142 R28C probably damaging Het
Lama2 T A 10: 26,990,870 D2876V probably damaging Het
Lmbrd2 T C 15: 9,175,192 S397P probably damaging Het
Lmf2 C T 15: 89,352,358 probably null Het
Lrp2 A G 2: 69,506,453 I1325T probably benign Het
Ltbp2 A T 12: 84,803,902 C879* probably null Het
Map3k1 A G 13: 111,755,313 V1136A probably damaging Het
Mettl3 G T 14: 52,300,252 H84N probably benign Het
Mia2 A G 12: 59,109,087 probably null Het
Mlip G T 9: 77,239,579 T92K probably damaging Het
Nalcn T A 14: 123,464,701 Y466F probably benign Het
Nav2 T A 7: 49,551,950 L235* probably null Het
Nbn T C 4: 15,981,588 V560A probably benign Het
Ncln A T 10: 81,493,153 Y144N possibly damaging Het
Nfe2l2 A C 2: 75,679,421 D18E probably benign Het
Olfr102 A G 17: 37,313,713 F224L probably benign Het
Olfr1131 T C 2: 87,628,607 I48T possibly damaging Het
Olfr356 T C 2: 36,937,709 C197R possibly damaging Het
Olfr432 G A 1: 174,050,525 A51T probably benign Het
Otop3 A T 11: 115,339,395 M33L probably benign Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phf14 T C 6: 11,953,423 I387T possibly damaging Het
Prdm9 T A 17: 15,554,698 N318Y probably damaging Het
Proca1 A G 11: 78,204,911 D123G probably damaging Het
Prune2 G A 19: 17,120,719 G1196S probably benign Het
Psd3 T A 8: 68,121,056 S158C probably damaging Het
Rps18 A G 17: 33,955,136 V15A probably benign Het
Sharpin C A 15: 76,347,765 R271L possibly damaging Het
Smad5 C A 13: 56,723,888 Q99K probably damaging Het
Sox5 T C 6: 144,116,474 M151V possibly damaging Het
Sphkap A T 1: 83,278,771 F419Y possibly damaging Het
Tbx20 T A 9: 24,725,525 Y422F probably damaging Het
Tcirg1 A C 19: 3,899,099 F397V probably damaging Het
Tex36 G A 7: 133,595,283 S35F possibly damaging Het
Tsen54 G T 11: 115,814,934 A26S unknown Het
Tubb5 G A 17: 35,838,275 probably benign Het
Usp50 T A 2: 126,780,330 probably null Het
Vmn2r5 A T 3: 64,491,288 F757I probably benign Het
Zbbx T C 3: 75,155,442 T3A possibly damaging Het
Zfp28 T A 7: 6,389,829 M168K probably benign Het
Zfp568 G T 7: 30,023,126 G499W probably damaging Het
Zfp7 C G 15: 76,890,931 P391R possibly damaging Het
Other mutations in Kcnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02263:Kcnn3 APN 3 89661218 missense possibly damaging 0.73
IGL02444:Kcnn3 APN 3 89652052 missense possibly damaging 0.50
IGL02500:Kcnn3 APN 3 89661112 splice site probably benign
IGL02814:Kcnn3 APN 3 89521175 missense possibly damaging 0.94
IGL02821:Kcnn3 APN 3 89662722 missense possibly damaging 0.84
IGL02821:Kcnn3 APN 3 89520974 missense possibly damaging 0.91
IGL02852:Kcnn3 APN 3 89609616 missense probably damaging 0.96
IGL02942:Kcnn3 APN 3 89652076 missense probably benign 0.00
IGL03118:Kcnn3 APN 3 89667161 missense probably damaging 1.00
R0015:Kcnn3 UTSW 3 89662773 missense probably damaging 1.00
R0015:Kcnn3 UTSW 3 89662773 missense probably damaging 1.00
R0032:Kcnn3 UTSW 3 89520665 small deletion probably benign
R0370:Kcnn3 UTSW 3 89667092 missense probably damaging 0.98
R0619:Kcnn3 UTSW 3 89652030 missense probably damaging 1.00
R1167:Kcnn3 UTSW 3 89564952 nonsense probably null
R1255:Kcnn3 UTSW 3 89652109 missense possibly damaging 0.84
R1643:Kcnn3 UTSW 3 89520497 missense unknown
R1733:Kcnn3 UTSW 3 89652090 missense probably benign 0.00
R1793:Kcnn3 UTSW 3 89609405 missense probably benign 0.20
R1827:Kcnn3 UTSW 3 89520994 missense possibly damaging 0.75
R1899:Kcnn3 UTSW 3 89520455 start gained probably benign
R2055:Kcnn3 UTSW 3 89521375 missense probably damaging 1.00
R2843:Kcnn3 UTSW 3 89520665 small deletion probably benign
R2922:Kcnn3 UTSW 3 89521022 missense probably damaging 1.00
R4078:Kcnn3 UTSW 3 89661188 missense possibly damaging 0.68
R4227:Kcnn3 UTSW 3 89521175 missense possibly damaging 0.94
R4604:Kcnn3 UTSW 3 89520420 start gained probably benign
R4814:Kcnn3 UTSW 3 89662724 missense probably damaging 1.00
R4822:Kcnn3 UTSW 3 89667289 missense possibly damaging 0.93
R5175:Kcnn3 UTSW 3 89609439 missense probably damaging 1.00
R5211:Kcnn3 UTSW 3 89521231 missense probably benign 0.04
R5438:Kcnn3 UTSW 3 89521298 missense probably damaging 1.00
R5496:Kcnn3 UTSW 3 89609490 missense possibly damaging 0.95
R6244:Kcnn3 UTSW 3 89645523 nonsense probably null
R7391:Kcnn3 UTSW 3 89609471 missense probably benign 0.34
R7625:Kcnn3 UTSW 3 89609670 missense probably damaging 0.99
R7834:Kcnn3 UTSW 3 89521354 missense probably damaging 1.00
R8022:Kcnn3 UTSW 3 89609703 missense possibly damaging 0.92
R8220:Kcnn3 UTSW 3 89661241 missense probably benign 0.14
Z1088:Kcnn3 UTSW 3 89667130 missense probably damaging 1.00
Z1177:Kcnn3 UTSW 3 89520923 missense probably damaging 1.00
Z1177:Kcnn3 UTSW 3 89661136 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGGTAGCCACACATGCAAG -3'
(R):5'- ATATCTGCCTCCCACAGCAG -3'

Sequencing Primer
(F):5'- CCTCAGATCAAGAATGCC -3'
(R):5'- ACAGCAGCCTGCCCACTG -3'
Posted On2020-06-30