Incidental Mutation 'R8110:Galnt9'
ID 630798
Institutional Source Beutler Lab
Gene Symbol Galnt9
Ensembl Gene ENSMUSG00000033316
Gene Name polypeptide N-acetylgalactosaminyltransferase 9
Synonyms GalNAc-T9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock # R8110 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 110544355-110621380 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 110615473 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Leucine at position 448 (W448L)
Ref Sequence ENSEMBL: ENSMUSP00000038633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040001] [ENSMUST00000165856] [ENSMUST00000200404]
AlphaFold G3X942
Predicted Effect probably damaging
Transcript: ENSMUST00000040001
AA Change: W448L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000038633
Gene: ENSMUSG00000033316
AA Change: W448L

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
Pfam:Glycos_transf_2 155 341 4.3e-26 PFAM
Blast:UBCc 425 457 3e-6 BLAST
RICIN 466 596 6.74e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165856
AA Change: W81L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133111
Gene: ENSMUSG00000033316
AA Change: W81L

DomainStartEndE-ValueType
Blast:UBCc 58 90 1e-6 BLAST
RICIN 99 229 6.74e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200404
AA Change: W81L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143647
Gene: ENSMUSG00000033316
AA Change: W81L

DomainStartEndE-ValueType
PDB:1XHB|A 1 132 7e-27 PDB
Blast:UBCc 58 90 2e-7 BLAST
SCOP:d1abrb1 92 133 8e-5 SMART
Blast:RICIN 99 136 1e-18 BLAST
Meta Mutation Damage Score 0.9110 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. This gene is expressed specifically in the brain, with highest expression in the cerebellum. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G T 11: 23,576,764 T696N probably benign Het
Ankrd45 T C 1: 161,151,319 probably null Het
Appl1 C A 14: 26,927,794 G592* probably null Het
Arfgef2 T A 2: 166,878,544 M1501K probably benign Het
Calcrl C T 2: 84,339,339 A333T probably damaging Het
Cd200r3 T A 16: 44,951,472 I33N probably benign Het
Ceacam15 A G 7: 16,673,409 L61P probably benign Het
Cfap69 T A 5: 5,582,515 H827L possibly damaging Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Cyp2u1 G A 3: 131,293,654 T426I probably damaging Het
Eefsec A C 6: 88,376,330 I119S probably damaging Het
Fem1b T C 9: 62,796,268 N570S probably damaging Het
Fmo9 A G 1: 166,663,526 M461T probably benign Het
Fryl A G 5: 73,133,277 Y95H probably benign Het
Fsip2 T C 2: 82,958,673 I346T probably benign Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gabbr1 G C 17: 37,048,583 S150T probably benign Het
Gcnt2 G T 13: 40,917,722 probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm17727 T C 9: 35,778,033 *84W probably null Het
Gm8882 C T 6: 132,361,568 G229D unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd4 A G 5: 121,332,949 Y2633C possibly damaging Het
Hsd11b2 A G 8: 105,522,634 I214V probably damaging Het
Hspa12a T A 19: 58,821,013 E217V possibly damaging Het
Itih2 A G 2: 10,097,137 F845L probably damaging Het
Kcnn3 T A 3: 89,661,233 L606H probably damaging Het
Krt6b G A 15: 101,680,142 R28C probably damaging Het
Lama2 T A 10: 26,990,870 D2876V probably damaging Het
Lmbrd2 T C 15: 9,175,192 S397P probably damaging Het
Lmf2 C T 15: 89,352,358 probably null Het
Lrp2 A G 2: 69,506,453 I1325T probably benign Het
Ltbp2 A T 12: 84,803,902 C879* probably null Het
Map3k1 A G 13: 111,755,313 V1136A probably damaging Het
Mettl3 G T 14: 52,300,252 H84N probably benign Het
Mia2 A G 12: 59,109,087 probably null Het
Mlip G T 9: 77,239,579 T92K probably damaging Het
Nalcn T A 14: 123,464,701 Y466F probably benign Het
Nav2 T A 7: 49,551,950 L235* probably null Het
Nbn T C 4: 15,981,588 V560A probably benign Het
Ncln A T 10: 81,493,153 Y144N possibly damaging Het
Nfe2l2 A C 2: 75,679,421 D18E probably benign Het
Olfr102 A G 17: 37,313,713 F224L probably benign Het
Olfr1131 T C 2: 87,628,607 I48T possibly damaging Het
Olfr356 T C 2: 36,937,709 C197R possibly damaging Het
Olfr432 G A 1: 174,050,525 A51T probably benign Het
Otop3 A T 11: 115,339,395 M33L probably benign Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phf14 T C 6: 11,953,423 I387T possibly damaging Het
Prdm9 T A 17: 15,554,698 N318Y probably damaging Het
Proca1 A G 11: 78,204,911 D123G probably damaging Het
Prune2 G A 19: 17,120,719 G1196S probably benign Het
Psd3 T A 8: 68,121,056 S158C probably damaging Het
Rps18 A G 17: 33,955,136 V15A probably benign Het
Sharpin C A 15: 76,347,765 R271L possibly damaging Het
Smad5 C A 13: 56,723,888 Q99K probably damaging Het
Sox5 T C 6: 144,116,474 M151V possibly damaging Het
Sphkap A T 1: 83,278,771 F419Y possibly damaging Het
Tbx20 T A 9: 24,725,525 Y422F probably damaging Het
Tcirg1 A C 19: 3,899,099 F397V probably damaging Het
Tex36 G A 7: 133,595,283 S35F possibly damaging Het
Tsen54 G T 11: 115,814,934 A26S unknown Het
Usp50 T A 2: 126,780,330 probably null Het
Vmn2r5 A T 3: 64,491,288 F757I probably benign Het
Zbbx T C 3: 75,155,442 T3A possibly damaging Het
Zfp28 T A 7: 6,389,829 M168K probably benign Het
Zfp568 G T 7: 30,023,126 G499W probably damaging Het
Zfp7 C G 15: 76,890,931 P391R possibly damaging Het
Other mutations in Galnt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01746:Galnt9 APN 5 110588322 missense probably damaging 1.00
IGL01934:Galnt9 APN 5 110602636 missense possibly damaging 0.56
IGL02394:Galnt9 APN 5 110615499 missense probably damaging 0.99
IGL02468:Galnt9 APN 5 110614223 missense possibly damaging 0.68
garnished UTSW 5 110588391 missense probably damaging 0.99
Spotless UTSW 5 110615509 missense probably damaging 1.00
varnished UTSW 5 110620599 missense probably damaging 1.00
R1494:Galnt9 UTSW 5 110588330 missense probably damaging 1.00
R1703:Galnt9 UTSW 5 110619172 missense probably damaging 1.00
R1717:Galnt9 UTSW 5 110596212 missense probably benign 0.01
R1806:Galnt9 UTSW 5 110619253 missense possibly damaging 0.77
R1855:Galnt9 UTSW 5 110615524 missense probably damaging 1.00
R4039:Galnt9 UTSW 5 110614208 missense probably damaging 1.00
R4388:Galnt9 UTSW 5 110588391 missense probably damaging 0.99
R4636:Galnt9 UTSW 5 110615499 missense probably damaging 0.99
R4693:Galnt9 UTSW 5 110615509 missense probably damaging 1.00
R4921:Galnt9 UTSW 5 110577449 missense probably damaging 0.96
R4925:Galnt9 UTSW 5 110544739 missense possibly damaging 0.54
R5040:Galnt9 UTSW 5 110617905 missense probably damaging 1.00
R5239:Galnt9 UTSW 5 110544769 missense probably damaging 1.00
R5839:Galnt9 UTSW 5 110577520 missense probably benign
R5918:Galnt9 UTSW 5 110615466 missense probably damaging 1.00
R6734:Galnt9 UTSW 5 110620599 missense probably damaging 1.00
R6775:Galnt9 UTSW 5 110620599 missense probably damaging 1.00
R6777:Galnt9 UTSW 5 110620599 missense probably damaging 1.00
R6784:Galnt9 UTSW 5 110620599 missense probably damaging 1.00
R7214:Galnt9 UTSW 5 110589828 missense probably benign
R7340:Galnt9 UTSW 5 110614188 missense probably damaging 0.99
R7522:Galnt9 UTSW 5 110595839 splice site probably null
R8423:Galnt9 UTSW 5 110596245 missense probably benign 0.00
R8479:Galnt9 UTSW 5 110544751 missense probably benign
R9007:Galnt9 UTSW 5 110544799 missense probably benign 0.00
R9060:Galnt9 UTSW 5 110589844 missense possibly damaging 0.88
R9213:Galnt9 UTSW 5 110619242 nonsense probably null
Z1176:Galnt9 UTSW 5 110596146 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCACACAAGTCACTTGAAGG -3'
(R):5'- CCACGTGGGCTCAATAGTAATTC -3'

Sequencing Primer
(F):5'- CTGTGCAGTCATAGTTAGGGAG -3'
(R):5'- CGTGGGCTCAATAGTAATTCTCTTTG -3'
Posted On 2020-06-30