Incidental Mutation 'R8110:Eefsec'
ID 630802
Institutional Source Beutler Lab
Gene Symbol Eefsec
Ensembl Gene ENSMUSG00000033216
Gene Name eukaryotic elongation factor, selenocysteine-tRNA-specific
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.895) question?
Stock # R8110 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 88257334-88446539 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 88376330 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 119 (I119S)
Ref Sequence ENSEMBL: ENSMUSP00000131207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165242] [ENSMUST00000203213] [ENSMUST00000203886] [ENSMUST00000204459] [ENSMUST00000205014] [ENSMUST00000205179]
AlphaFold Q9JHW4
Predicted Effect probably damaging
Transcript: ENSMUST00000165242
AA Change: I119S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131207
Gene: ENSMUSG00000033216
AA Change: I119S

DomainStartEndE-ValueType
Pfam:GTP_EFTU 5 284 1.7e-27 PFAM
Pfam:SRPRB 6 161 9e-7 PFAM
Pfam:MMR_HSR1 9 133 6.2e-6 PFAM
Pfam:GTP_EFTU_D2 224 290 4.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203213
AA Change: I21S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145480
Gene: ENSMUSG00000033216
AA Change: I21S

DomainStartEndE-ValueType
Pfam:GTP_EFTU 1 157 1.4e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203886
AA Change: I21S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145017
Gene: ENSMUSG00000033216
AA Change: I21S

DomainStartEndE-ValueType
Pfam:GTP_EFTU 1 205 1e-6 PFAM
Pfam:GTP_EFTU_D2 126 192 1e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204459
AA Change: I119S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144824
Gene: ENSMUSG00000033216
AA Change: I119S

DomainStartEndE-ValueType
Pfam:GTP_EFTU 5 203 1.5e-26 PFAM
Pfam:SRPRB 6 161 1.8e-5 PFAM
Pfam:MMR_HSR1 9 133 2.4e-5 PFAM
Pfam:cobW 74 161 1.3e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205014
SMART Domains Protein: ENSMUSP00000145448
Gene: ENSMUSG00000033216

DomainStartEndE-ValueType
Pfam:GTP_EFTU 5 93 2.4e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000205179
AA Change: I119S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144839
Gene: ENSMUSG00000033216
AA Change: I119S

DomainStartEndE-ValueType
Pfam:GTP_EFTU 5 285 6e-26 PFAM
Pfam:SRPRB 6 161 8e-5 PFAM
Pfam:MMR_HSR1 9 133 1e-4 PFAM
Pfam:GTP_EFTU_D2 224 290 3.3e-7 PFAM
Meta Mutation Damage Score 0.9598 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.1%
Validation Efficiency 99% (73/74)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G T 11: 23,576,764 T696N probably benign Het
Ankrd45 T C 1: 161,151,319 probably null Het
Appl1 C A 14: 26,927,794 G592* probably null Het
Arfgef2 T A 2: 166,878,544 M1501K probably benign Het
Calcrl C T 2: 84,339,339 A333T probably damaging Het
Cd200r3 T A 16: 44,951,472 I33N probably benign Het
Ceacam15 A G 7: 16,673,409 L61P probably benign Het
Cfap69 T A 5: 5,582,515 H827L possibly damaging Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Cyp2u1 G A 3: 131,293,654 T426I probably damaging Het
Fem1b T C 9: 62,796,268 N570S probably damaging Het
Fmo9 A G 1: 166,663,526 M461T probably benign Het
Fryl A G 5: 73,133,277 Y95H probably benign Het
Fsip2 T C 2: 82,958,673 I346T probably benign Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gabbr1 G C 17: 37,048,583 S150T probably benign Het
Galnt9 G T 5: 110,615,473 W448L probably damaging Het
Gcnt2 G T 13: 40,917,722 probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm17727 T C 9: 35,778,033 *84W probably null Het
Gm8882 C T 6: 132,361,568 G229D unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd4 A G 5: 121,332,949 Y2633C possibly damaging Het
Hsd11b2 A G 8: 105,522,634 I214V probably damaging Het
Hspa12a T A 19: 58,821,013 E217V possibly damaging Het
Itih2 A G 2: 10,097,137 F845L probably damaging Het
Kcnn3 T A 3: 89,661,233 L606H probably damaging Het
Krt6b G A 15: 101,680,142 R28C probably damaging Het
Lama2 T A 10: 26,990,870 D2876V probably damaging Het
Lmbrd2 T C 15: 9,175,192 S397P probably damaging Het
Lmf2 C T 15: 89,352,358 probably null Het
Lrp2 A G 2: 69,506,453 I1325T probably benign Het
Ltbp2 A T 12: 84,803,902 C879* probably null Het
Map3k1 A G 13: 111,755,313 V1136A probably damaging Het
Mettl3 G T 14: 52,300,252 H84N probably benign Het
Mia2 A G 12: 59,109,087 probably null Het
Mlip G T 9: 77,239,579 T92K probably damaging Het
Nalcn T A 14: 123,464,701 Y466F probably benign Het
Nav2 T A 7: 49,551,950 L235* probably null Het
Nbn T C 4: 15,981,588 V560A probably benign Het
Ncln A T 10: 81,493,153 Y144N possibly damaging Het
Nfe2l2 A C 2: 75,679,421 D18E probably benign Het
Olfr102 A G 17: 37,313,713 F224L probably benign Het
Olfr1131 T C 2: 87,628,607 I48T possibly damaging Het
Olfr356 T C 2: 36,937,709 C197R possibly damaging Het
Olfr432 G A 1: 174,050,525 A51T probably benign Het
Otop3 A T 11: 115,339,395 M33L probably benign Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phf14 T C 6: 11,953,423 I387T possibly damaging Het
Prdm9 T A 17: 15,554,698 N318Y probably damaging Het
Proca1 A G 11: 78,204,911 D123G probably damaging Het
Prune2 G A 19: 17,120,719 G1196S probably benign Het
Psd3 T A 8: 68,121,056 S158C probably damaging Het
Rps18 A G 17: 33,955,136 V15A probably benign Het
Sharpin C A 15: 76,347,765 R271L possibly damaging Het
Smad5 C A 13: 56,723,888 Q99K probably damaging Het
Sox5 T C 6: 144,116,474 M151V possibly damaging Het
Sphkap A T 1: 83,278,771 F419Y possibly damaging Het
Tbx20 T A 9: 24,725,525 Y422F probably damaging Het
Tcirg1 A C 19: 3,899,099 F397V probably damaging Het
Tex36 G A 7: 133,595,283 S35F possibly damaging Het
Tsen54 G T 11: 115,814,934 A26S unknown Het
Usp50 T A 2: 126,780,330 probably null Het
Vmn2r5 A T 3: 64,491,288 F757I probably benign Het
Zbbx T C 3: 75,155,442 T3A possibly damaging Het
Zfp28 T A 7: 6,389,829 M168K probably benign Het
Zfp568 G T 7: 30,023,126 G499W probably damaging Het
Zfp7 C G 15: 76,890,931 P391R possibly damaging Het
Other mutations in Eefsec
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Eefsec APN 6 88376279 missense possibly damaging 0.82
IGL02055:Eefsec APN 6 88376403 missense probably damaging 1.00
IGL03068:Eefsec APN 6 88258227 missense probably benign 0.00
IGL03235:Eefsec APN 6 88376375 missense probably damaging 1.00
R0137:Eefsec UTSW 6 88297649 missense probably benign 0.17
R0384:Eefsec UTSW 6 88281650 splice site probably null
R0456:Eefsec UTSW 6 88297888 missense probably benign 0.01
R0571:Eefsec UTSW 6 88297899 missense probably benign 0.00
R1051:Eefsec UTSW 6 88297847 missense probably benign 0.00
R1464:Eefsec UTSW 6 88376200 splice site probably benign
R1552:Eefsec UTSW 6 88376200 splice site probably benign
R1739:Eefsec UTSW 6 88376205 nonsense probably null
R2887:Eefsec UTSW 6 88258359 missense probably benign 0.01
R3944:Eefsec UTSW 6 88298094 missense probably benign 0.04
R4027:Eefsec UTSW 6 88376250 missense probably benign 0.22
R5113:Eefsec UTSW 6 88281575 missense probably damaging 1.00
R5924:Eefsec UTSW 6 88355547 missense probably damaging 0.99
R6062:Eefsec UTSW 6 88355629 missense probably benign 0.04
R6233:Eefsec UTSW 6 88358544 critical splice donor site probably null
R6484:Eefsec UTSW 6 88297788 missense probably damaging 0.99
R6524:Eefsec UTSW 6 88297920 splice site probably null
R6903:Eefsec UTSW 6 88446283 missense probably benign 0.45
R7614:Eefsec UTSW 6 88281594 missense possibly damaging 0.64
R7733:Eefsec UTSW 6 88376220 missense possibly damaging 0.80
R8850:Eefsec UTSW 6 88446271 missense possibly damaging 0.73
R9251:Eefsec UTSW 6 88355592 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTCCACTTACCAGGATGGGAG -3'
(R):5'- AGGAAGTATCAGCCATTCCTCC -3'

Sequencing Primer
(F):5'- CTTACCAGGATGGGAGGCTGAC -3'
(R):5'- GAAGTATCAGCCATTCCTCCCCATC -3'
Posted On 2020-06-30