Mutagenetix > Incidental Mutations

Incidental Mutation 'R8110:Nav2'

630808

Institutional Source

Beutler Lab

Gene Symbol

Nav2

Ensembl Gene

ENSMUSG00000052512

Gene Name

neuron navigator 2

Synonyms

Rainb1, HELAD1, Unc53H2, RAINB2, 5330421F07Rik, POMFIL2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.640) question?

Stock #

R8110 (G1)

Quality Score

146.008

Status

Validated

Chromosome

Chromosomal Location

48908716-49610090 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 49551950 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 235 (L235*)

Ref Sequence

ENSEMBL: ENSMUSP00000138846 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184109] [ENSMUST00000184945]

Predicted Effect

probably null
Transcript: ENSMUST00000064395
AA Change: L1424*

SMART Domains

Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: L1424*

Domain	Start	End	E-Value	Type
CH	84	187	1.58e-13	SMART
low complexity region	202	210	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	337	348	N/A	INTRINSIC
low complexity region	412	424	N/A	INTRINSIC
coiled coil region	486	516	N/A	INTRINSIC
low complexity region	580	591	N/A	INTRINSIC
low complexity region	613	625	N/A	INTRINSIC
low complexity region	640	662	N/A	INTRINSIC
low complexity region	846	857	N/A	INTRINSIC
low complexity region	920	944	N/A	INTRINSIC
low complexity region	947	967	N/A	INTRINSIC
low complexity region	990	1004	N/A	INTRINSIC
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1343	1360	N/A	INTRINSIC
low complexity region	1368	1385	N/A	INTRINSIC
low complexity region	1417	1432	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1614	1628	N/A	INTRINSIC
coiled coil region	1630	1717	N/A	INTRINSIC
low complexity region	1789	1800	N/A	INTRINSIC
coiled coil region	1841	1909	N/A	INTRINSIC
AAA	2093	2247	1.69e-5	SMART
low complexity region	2404	2430	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000183659
AA Change: L1363*

SMART Domains

Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: L1363*

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
CH	23	126	6.19e-16	SMART
low complexity region	141	149	N/A	INTRINSIC
low complexity region	236	249	N/A	INTRINSIC
low complexity region	276	287	N/A	INTRINSIC
low complexity region	351	363	N/A	INTRINSIC
coiled coil region	425	455	N/A	INTRINSIC
low complexity region	519	530	N/A	INTRINSIC
low complexity region	552	564	N/A	INTRINSIC
low complexity region	579	601	N/A	INTRINSIC
low complexity region	785	796	N/A	INTRINSIC
low complexity region	859	883	N/A	INTRINSIC
low complexity region	886	906	N/A	INTRINSIC
low complexity region	929	943	N/A	INTRINSIC
low complexity region	1001	1013	N/A	INTRINSIC
low complexity region	1282	1299	N/A	INTRINSIC
low complexity region	1307	1324	N/A	INTRINSIC
low complexity region	1356	1371	N/A	INTRINSIC
low complexity region	1393	1405	N/A	INTRINSIC
low complexity region	1465	1479	N/A	INTRINSIC
low complexity region	1553	1567	N/A	INTRINSIC
coiled coil region	1569	1656	N/A	INTRINSIC
low complexity region	1728	1739	N/A	INTRINSIC
coiled coil region	1780	1848	N/A	INTRINSIC
AAA	2032	2186	1.69e-5	SMART
low complexity region	2343	2369	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000184109
AA Change: L235*

SMART Domains

Protein: ENSMUSP00000138846
Gene: ENSMUSG00000052512
AA Change: L235*

Domain	Start	End	E-Value	Type
low complexity region	154	171	N/A	INTRINSIC
low complexity region	179	196	N/A	INTRINSIC
low complexity region	228	243	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000184945
AA Change: L1424*

SMART Domains

Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: L1424*

Domain	Start	End	E-Value	Type
CH	84	187	1.58e-13	SMART
low complexity region	202	210	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	337	348	N/A	INTRINSIC
low complexity region	412	424	N/A	INTRINSIC
coiled coil region	486	516	N/A	INTRINSIC
low complexity region	580	591	N/A	INTRINSIC
low complexity region	613	625	N/A	INTRINSIC
low complexity region	640	662	N/A	INTRINSIC
low complexity region	846	857	N/A	INTRINSIC
low complexity region	920	944	N/A	INTRINSIC
low complexity region	947	967	N/A	INTRINSIC
low complexity region	990	1004	N/A	INTRINSIC
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1343	1360	N/A	INTRINSIC
low complexity region	1368	1385	N/A	INTRINSIC
low complexity region	1417	1432	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1614	1628	N/A	INTRINSIC
coiled coil region	1630	1717	N/A	INTRINSIC
low complexity region	1789	1800	N/A	INTRINSIC
coiled coil region	1841	1909	N/A	INTRINSIC
AAA	2093	2247	1.69e-5	SMART
low complexity region	2404	2430	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 93.1%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	G	T	11: 23,576,764	T696N	probably benign	Het
Ankrd45	T	C	1: 161,151,319		probably null	Het
Appl1	C	A	14: 26,927,794	G592*	probably null	Het
Arfgef2	T	A	2: 166,878,544	M1501K	probably benign	Het
Calcrl	C	T	2: 84,339,339	A333T	probably damaging	Het
Cd200r3	T	A	16: 44,951,472	I33N	probably benign	Het
Ceacam15	A	G	7: 16,673,409	L61P	probably benign	Het
Cfap69	T	A	5: 5,582,515	H827L	possibly damaging	Het
Csmd3	T	A	15: 47,644,270	E2780V	probably damaging	Het
Cyp2u1	G	A	3: 131,293,654	T426I	probably damaging	Het
Eefsec	A	C	6: 88,376,330	I119S	probably damaging	Het
Fem1b	T	C	9: 62,796,268	N570S	probably damaging	Het
Fmo9	A	G	1: 166,663,526	M461T	probably benign	Het
Fryl	A	G	5: 73,133,277	Y95H	probably benign	Het
Fsip2	T	C	2: 82,958,673	I346T	probably benign	Het
Fto	T	C	8: 91,485,190	F381S	probably damaging	Het
Gabbr1	G	C	17: 37,048,583	S150T	probably benign	Het
Galnt9	G	T	5: 110,615,473	W448L	probably damaging	Het
Gcnt2	G	T	13: 40,917,722		probably benign	Het
Gm10800	CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA	CAAGAAAACTGAAAATCA	2: 98,667,016		probably null	Het
Gm17727	T	C	9: 35,778,033	*84W	probably null	Het
Gm8882	C	T	6: 132,361,568	G229D	unknown	Het
Gmcl1	G	T	6: 86,721,426	A163E	probably damaging	Het
Hectd4	A	G	5: 121,332,949	Y2633C	possibly damaging	Het
Hsd11b2	A	G	8: 105,522,634	I214V	probably damaging	Het
Hspa12a	T	A	19: 58,821,013	E217V	possibly damaging	Het
Itih2	A	G	2: 10,097,137	F845L	probably damaging	Het
Kcnn3	T	A	3: 89,661,233	L606H	probably damaging	Het
Krt6b	G	A	15: 101,680,142	R28C	probably damaging	Het
Lama2	T	A	10: 26,990,870	D2876V	probably damaging	Het
Lmbrd2	T	C	15: 9,175,192	S397P	probably damaging	Het
Lmf2	C	T	15: 89,352,358		probably null	Het
Lrp2	A	G	2: 69,506,453	I1325T	probably benign	Het
Ltbp2	A	T	12: 84,803,902	C879*	probably null	Het
Map3k1	A	G	13: 111,755,313	V1136A	probably damaging	Het
Mettl3	G	T	14: 52,300,252	H84N	probably benign	Het
Mia2	A	G	12: 59,109,087		probably null	Het
Mlip	G	T	9: 77,239,579	T92K	probably damaging	Het
Nalcn	T	A	14: 123,464,701	Y466F	probably benign	Het
Nbn	T	C	4: 15,981,588	V560A	probably benign	Het
Ncln	A	T	10: 81,493,153	Y144N	possibly damaging	Het
Nfe2l2	A	C	2: 75,679,421	D18E	probably benign	Het
Olfr102	A	G	17: 37,313,713	F224L	probably benign	Het
Olfr1131	T	C	2: 87,628,607	I48T	possibly damaging	Het
Olfr356	T	C	2: 36,937,709	C197R	possibly damaging	Het
Olfr432	G	A	1: 174,050,525	A51T	probably benign	Het
Otop3	A	T	11: 115,339,395	M33L	probably benign	Het
Pdzd2	G	A	15: 12,373,506	S2181L	probably benign	Het
Phf14	T	C	6: 11,953,423	I387T	possibly damaging	Het
Prdm9	T	A	17: 15,554,698	N318Y	probably damaging	Het
Proca1	A	G	11: 78,204,911	D123G	probably damaging	Het
Prune2	G	A	19: 17,120,719	G1196S	probably benign	Het
Psd3	T	A	8: 68,121,056	S158C	probably damaging	Het
Rps18	A	G	17: 33,955,136	V15A	probably benign	Het
Sharpin	C	A	15: 76,347,765	R271L	possibly damaging	Het
Smad5	C	A	13: 56,723,888	Q99K	probably damaging	Het
Sox5	T	C	6: 144,116,474	M151V	possibly damaging	Het
Sphkap	A	T	1: 83,278,771	F419Y	possibly damaging	Het
Tbx20	T	A	9: 24,725,525	Y422F	probably damaging	Het
Tcirg1	A	C	19: 3,899,099	F397V	probably damaging	Het
Tex36	G	A	7: 133,595,283	S35F	possibly damaging	Het
Tsen54	G	T	11: 115,814,934	A26S	unknown	Het
Usp50	T	A	2: 126,780,330		probably null	Het
Vmn2r5	A	T	3: 64,491,288	F757I	probably benign	Het
Zbbx	T	C	3: 75,155,442	T3A	possibly damaging	Het
Zfp28	T	A	7: 6,389,829	M168K	probably benign	Het
Zfp568	G	T	7: 30,023,126	G499W	probably damaging	Het
Zfp7	C	G	15: 76,890,931	P391R	possibly damaging	Het

Other mutations in Nav2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01097:Nav2	APN	7	49571194	missense	probably damaging	1.00
IGL01150:Nav2	APN	7	49452521	missense	probably benign	0.17
IGL01649:Nav2	APN	7	49575729	missense	probably damaging	1.00
IGL01662:Nav2	APN	7	49571209	missense	probably damaging	1.00
IGL02297:Nav2	APN	7	49594229	missense	probably damaging	0.98
IGL02313:Nav2	APN	7	49558773	missense	probably damaging	0.99
IGL02441:Nav2	APN	7	49452512	missense	probably damaging	1.00
IGL02472:Nav2	APN	7	49546041	missense	probably damaging	1.00
IGL02477:Nav2	APN	7	49582875	missense	probably damaging	0.99
IGL02725:Nav2	APN	7	49565095	missense	probably damaging	1.00
IGL02944:Nav2	APN	7	49420256	missense	probably damaging	0.99
IGL02953:Nav2	APN	7	49548423	missense	probably damaging	1.00
IGL03105:Nav2	APN	7	49464879	missense	probably damaging	1.00
IGL03234:Nav2	APN	7	49462008	missense	possibly damaging	0.94
IGL03274:Nav2	APN	7	49362099	missense	probably damaging	1.00
IGL03294:Nav2	APN	7	49491457	nonsense	probably null
R0006:Nav2	UTSW	7	49453230	missense	possibly damaging	0.50
R0070:Nav2	UTSW	7	49570714	missense	probably damaging	1.00
R0113:Nav2	UTSW	7	49535953	missense	probably damaging	1.00
R0306:Nav2	UTSW	7	49545903	missense	probably benign	0.01
R0346:Nav2	UTSW	7	49604585	missense	probably benign	0.11
R0539:Nav2	UTSW	7	49461938	missense	probably damaging	1.00
R0669:Nav2	UTSW	7	49408683	missense	probably damaging	1.00
R0785:Nav2	UTSW	7	49420333	missense	probably benign	0.06
R0970:Nav2	UTSW	7	49584153	missense	probably damaging	1.00
R1162:Nav2	UTSW	7	49536040	splice site	probably benign
R1274:Nav2	UTSW	7	49604430	nonsense	probably null
R1463:Nav2	UTSW	7	49535962	missense	probably damaging	1.00
R1464:Nav2	UTSW	7	49362204	missense	probably damaging	1.00
R1464:Nav2	UTSW	7	49362204	missense	probably damaging	1.00
R1536:Nav2	UTSW	7	49545934	missense	probably damaging	1.00
R1612:Nav2	UTSW	7	49571211	missense	probably damaging	1.00
R1638:Nav2	UTSW	7	49452465	missense	probably benign
R1731:Nav2	UTSW	7	49548174	missense	probably damaging	1.00
R1734:Nav2	UTSW	7	49575720	missense	probably damaging	1.00
R1865:Nav2	UTSW	7	49548195	missense	possibly damaging	0.95
R1945:Nav2	UTSW	7	49464872	missense	probably damaging	1.00
R1997:Nav2	UTSW	7	49548471	missense	probably benign	0.16
R2061:Nav2	UTSW	7	49598897	splice site	probably benign
R2117:Nav2	UTSW	7	49464580	missense	probably benign	0.00
R2174:Nav2	UTSW	7	49452663	missense	probably damaging	0.99
R2182:Nav2	UTSW	7	49597254	missense	probably benign	0.38
R2251:Nav2	UTSW	7	49453277	missense	probably damaging	1.00
R2283:Nav2	UTSW	7	49491404	missense	probably damaging	1.00
R2343:Nav2	UTSW	7	49598817	missense	possibly damaging	0.82
R2472:Nav2	UTSW	7	49408884	missense	probably benign
R2568:Nav2	UTSW	7	49597564	missense	probably damaging	1.00
R2656:Nav2	UTSW	7	49545942	missense	probably damaging	1.00
R2964:Nav2	UTSW	7	49557032	missense	probably damaging	1.00
R2966:Nav2	UTSW	7	49557032	missense	probably damaging	1.00
R3817:Nav2	UTSW	7	49464562	missense	probably benign	0.00
R3834:Nav2	UTSW	7	49545858	missense	possibly damaging	0.91
R4207:Nav2	UTSW	7	49572298	splice site	probably null
R4207:Nav2	UTSW	7	49597231	missense	probably damaging	1.00
R4411:Nav2	UTSW	7	49398109	missense	probably benign	0.37
R4413:Nav2	UTSW	7	49398109	missense	probably benign	0.37
R4440:Nav2	UTSW	7	49552037	missense	possibly damaging	0.86
R4440:Nav2	UTSW	7	49575263	splice site	probably benign
R4454:Nav2	UTSW	7	49548544	splice site	probably null
R4729:Nav2	UTSW	7	49452819	missense	probably benign	0.17
R4801:Nav2	UTSW	7	49545852	missense	possibly damaging	0.94
R4802:Nav2	UTSW	7	49545852	missense	possibly damaging	0.94
R4824:Nav2	UTSW	7	49409001	intron	probably benign
R4887:Nav2	UTSW	7	49548434	nonsense	probably null
R4908:Nav2	UTSW	7	49604510	missense	probably damaging	1.00
R4952:Nav2	UTSW	7	49304540	intron	probably benign
R4965:Nav2	UTSW	7	49552877	nonsense	probably null
R5169:Nav2	UTSW	7	49548483	nonsense	probably null
R5224:Nav2	UTSW	7	49551725	missense	probably benign	0.00
R5249:Nav2	UTSW	7	49535913	missense	probably damaging	1.00
R5285:Nav2	UTSW	7	49548234	missense	probably damaging	1.00
R5314:Nav2	UTSW	7	49408692	small deletion	probably benign
R5320:Nav2	UTSW	7	49491373	missense	probably benign	0.00
R5377:Nav2	UTSW	7	49589160	missense	probably benign	0.02
R5471:Nav2	UTSW	7	49548169	missense	probably damaging	1.00
R5754:Nav2	UTSW	7	49557046	missense	probably damaging	1.00
R5832:Nav2	UTSW	7	49548069	splice site	probably null
R5884:Nav2	UTSW	7	49597169	nonsense	probably null
R5921:Nav2	UTSW	7	49304576	intron	probably benign
R6180:Nav2	UTSW	7	49458167	missense	probably benign	0.39
R6208:Nav2	UTSW	7	49564103	missense	probably damaging	0.99
R6373:Nav2	UTSW	7	49453175	missense	probably damaging	1.00
R6450:Nav2	UTSW	7	49594366	missense	probably damaging	1.00
R6522:Nav2	UTSW	7	49597533	missense	probably damaging	1.00
R6626:Nav2	UTSW	7	49594352	missense	probably damaging	1.00
R6695:Nav2	UTSW	7	49464904	missense	probably benign	0.04
R6705:Nav2	UTSW	7	49551916	missense	probably damaging	1.00
R6842:Nav2	UTSW	7	49458169	missense	possibly damaging	0.91
R6847:Nav2	UTSW	7	49491456	missense	probably benign	0.14
R7287:Nav2	UTSW	7	49420328	missense	probably benign	0.01
R7312:Nav2	UTSW	7	49461924	missense	possibly damaging	0.55
R7315:Nav2	UTSW	7	49548289	missense	possibly damaging	0.61
R7337:Nav2	UTSW	7	49551773	missense	possibly damaging	0.56
R7366:Nav2	UTSW	7	49554203	splice site	probably null
R7451:Nav2	UTSW	7	49552829	splice site	probably null
R7545:Nav2	UTSW	7	49582857	missense	probably damaging	1.00
R7706:Nav2	UTSW	7	49594319	missense	probably benign	0.35
R7730:Nav2	UTSW	7	49572397	missense	probably damaging	1.00
R7812:Nav2	UTSW	7	49597173	missense	probably benign	0.13
R8097:Nav2	UTSW	7	49587777	missense	probably damaging	1.00
R8119:Nav2	UTSW	7	49453484	missense	probably damaging	0.99
R8298:Nav2	UTSW	7	49554261	critical splice donor site	probably null
R8306:Nav2	UTSW	7	49546017	missense	probably benign	0.33
R8331:Nav2	UTSW	7	49452623	missense	probably benign
R8402:Nav2	UTSW	7	49453437	missense	probably benign	0.43
R8421:Nav2	UTSW	7	49452521	missense	probably benign
R8478:Nav2	UTSW	7	49461985	missense	probably damaging	0.99
R8724:Nav2	UTSW	7	49491436	missense	possibly damaging	0.82
R8753:Nav2	UTSW	7	49452572	missense	probably benign
R8835:Nav2	UTSW	7	49598803	missense	possibly damaging	0.83
X0023:Nav2	UTSW	7	49547899	missense	possibly damaging	0.47
Z1177:Nav2	UTSW	7	49452761	missense	possibly damaging	0.47
Z1177:Nav2	UTSW	7	49594223	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CCCAGCAAGGTAACCTAGAGTC -3'
(R):5'- CTGCCAGGTAACAGCGAAGTAG -3'

Sequencing Primer
(F):5'- GCCCTCTCTACAGTAAGAACGTGG -3'
(R):5'- CAGCGAAGTAGTTTTTAGATCCC -3'

Posted On

2020-06-30