Incidental Mutation 'R8110:Fto'
ID 630811
Institutional Source Beutler Lab
Gene Symbol Fto
Ensembl Gene ENSMUSG00000055932
Gene Name fat mass and obesity associated
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8110 (G1)
Quality Score 200.009
Status Validated
Chromosome 8
Chromosomal Location 91313525-91668439 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 91485190 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 381 (F381S)
Ref Sequence ENSEMBL: ENSMUSP00000068380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069718] [ENSMUST00000128081] [ENSMUST00000136802]
AlphaFold Q8BGW1
Predicted Effect probably damaging
Transcript: ENSMUST00000069718
AA Change: F381S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068380
Gene: ENSMUSG00000055932
AA Change: F381S

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
FTO_NTD 35 323 2.71e-191 SMART
Pfam:FTO_CTD 326 495 1.1e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128081
AA Change: F381S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000136802
AA Change: F381S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a nuclear protein of the AlkB related non-haem iron and 2-oxoglutarate-dependent oxygenase superfamily but the exact physiological function of this gene is not known. Other non-heme iron enzymes function to reverse alkylated DNA and RNA damage by oxidative demethylation. Studies in mice and humans indicate a role in nervous and cardiovascular systems and a strong association with body mass index, obesity risk, and type 2 diabetes. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted knock-out allele exhibit decreased body weight, adipose tissue, and body fat and increased metabolism, serum lipids, and serum glucagon that may be gender and diet dependent. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G T 11: 23,576,764 T696N probably benign Het
Ankrd45 T C 1: 161,151,319 probably null Het
Appl1 C A 14: 26,927,794 G592* probably null Het
Arfgef2 T A 2: 166,878,544 M1501K probably benign Het
Calcrl C T 2: 84,339,339 A333T probably damaging Het
Cd200r3 T A 16: 44,951,472 I33N probably benign Het
Ceacam15 A G 7: 16,673,409 L61P probably benign Het
Cfap69 T A 5: 5,582,515 H827L possibly damaging Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Cyp2u1 G A 3: 131,293,654 T426I probably damaging Het
Eefsec A C 6: 88,376,330 I119S probably damaging Het
Fem1b T C 9: 62,796,268 N570S probably damaging Het
Fmo9 A G 1: 166,663,526 M461T probably benign Het
Fryl A G 5: 73,133,277 Y95H probably benign Het
Fsip2 T C 2: 82,958,673 I346T probably benign Het
Gabbr1 G C 17: 37,048,583 S150T probably benign Het
Galnt9 G T 5: 110,615,473 W448L probably damaging Het
Gcnt2 G T 13: 40,917,722 probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm17727 T C 9: 35,778,033 *84W probably null Het
Gm8882 C T 6: 132,361,568 G229D unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd4 A G 5: 121,332,949 Y2633C possibly damaging Het
Hsd11b2 A G 8: 105,522,634 I214V probably damaging Het
Hspa12a T A 19: 58,821,013 E217V possibly damaging Het
Itih2 A G 2: 10,097,137 F845L probably damaging Het
Kcnn3 T A 3: 89,661,233 L606H probably damaging Het
Krt6b G A 15: 101,680,142 R28C probably damaging Het
Lama2 T A 10: 26,990,870 D2876V probably damaging Het
Lmbrd2 T C 15: 9,175,192 S397P probably damaging Het
Lmf2 C T 15: 89,352,358 probably null Het
Lrp2 A G 2: 69,506,453 I1325T probably benign Het
Ltbp2 A T 12: 84,803,902 C879* probably null Het
Map3k1 A G 13: 111,755,313 V1136A probably damaging Het
Mettl3 G T 14: 52,300,252 H84N probably benign Het
Mia2 A G 12: 59,109,087 probably null Het
Mlip G T 9: 77,239,579 T92K probably damaging Het
Nalcn T A 14: 123,464,701 Y466F probably benign Het
Nav2 T A 7: 49,551,950 L235* probably null Het
Nbn T C 4: 15,981,588 V560A probably benign Het
Ncln A T 10: 81,493,153 Y144N possibly damaging Het
Nfe2l2 A C 2: 75,679,421 D18E probably benign Het
Olfr102 A G 17: 37,313,713 F224L probably benign Het
Olfr1131 T C 2: 87,628,607 I48T possibly damaging Het
Olfr356 T C 2: 36,937,709 C197R possibly damaging Het
Olfr432 G A 1: 174,050,525 A51T probably benign Het
Otop3 A T 11: 115,339,395 M33L probably benign Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phf14 T C 6: 11,953,423 I387T possibly damaging Het
Prdm9 T A 17: 15,554,698 N318Y probably damaging Het
Proca1 A G 11: 78,204,911 D123G probably damaging Het
Prune2 G A 19: 17,120,719 G1196S probably benign Het
Psd3 T A 8: 68,121,056 S158C probably damaging Het
Rps18 A G 17: 33,955,136 V15A probably benign Het
Sharpin C A 15: 76,347,765 R271L possibly damaging Het
Smad5 C A 13: 56,723,888 Q99K probably damaging Het
Sox5 T C 6: 144,116,474 M151V possibly damaging Het
Sphkap A T 1: 83,278,771 F419Y possibly damaging Het
Tbx20 T A 9: 24,725,525 Y422F probably damaging Het
Tcirg1 A C 19: 3,899,099 F397V probably damaging Het
Tex36 G A 7: 133,595,283 S35F possibly damaging Het
Tsen54 G T 11: 115,814,934 A26S unknown Het
Usp50 T A 2: 126,780,330 probably null Het
Vmn2r5 A T 3: 64,491,288 F757I probably benign Het
Zbbx T C 3: 75,155,442 T3A possibly damaging Het
Zfp28 T A 7: 6,389,829 M168K probably benign Het
Zfp568 G T 7: 30,023,126 G499W probably damaging Het
Zfp7 C G 15: 76,890,931 P391R possibly damaging Het
Other mutations in Fto
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Fto APN 8 91441716 missense probably benign 0.29
IGL01541:Fto APN 8 91409748 missense probably damaging 1.00
IGL01636:Fto APN 8 91409341 missense probably damaging 1.00
IGL01788:Fto APN 8 91409731 missense probably benign 0.25
IGL02016:Fto APN 8 91666406 nonsense probably null
IGL02365:Fto APN 8 91468375 missense probably damaging 1.00
IGL02639:Fto APN 8 91409528 missense probably damaging 1.00
IGL02926:Fto APN 8 91485167 missense probably damaging 1.00
IGL03194:Fto APN 8 91409787 missense probably damaging 1.00
R0091:Fto UTSW 8 91441807 critical splice donor site probably null
R0105:Fto UTSW 8 91522802 missense probably damaging 1.00
R0326:Fto UTSW 8 91409527 missense probably damaging 1.00
R0332:Fto UTSW 8 91401890 splice site probably benign
R0378:Fto UTSW 8 91474312 missense probably damaging 1.00
R0601:Fto UTSW 8 91401802 splice site probably null
R1526:Fto UTSW 8 91441686 missense possibly damaging 0.90
R2092:Fto UTSW 8 91409687 nonsense probably null
R4731:Fto UTSW 8 91409714 missense probably damaging 1.00
R4732:Fto UTSW 8 91409714 missense probably damaging 1.00
R4733:Fto UTSW 8 91409714 missense probably damaging 1.00
R5347:Fto UTSW 8 91391479 intron probably benign
R5840:Fto UTSW 8 91666440 utr 3 prime probably benign
R7213:Fto UTSW 8 91391507 missense probably benign 0.00
R7271:Fto UTSW 8 91485190 missense probably damaging 1.00
R7658:Fto UTSW 8 91666322 missense probably benign 0.34
R7763:Fto UTSW 8 91409443 missense probably damaging 0.99
R8700:Fto UTSW 8 91522833 missense probably damaging 0.96
R8915:Fto UTSW 8 91409843 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTCAAGCTTTTCTCGCC -3'
(R):5'- AAACAGAATTGCAGGCTGCTCC -3'

Sequencing Primer
(F):5'- AAGCTTTTCTCGCCTGCCTC -3'
(R):5'- TGGACGACGTATACATTTGCC -3'
Posted On 2020-06-30