Incidental Mutation 'R8110:Tbx20'
ID 630813
Institutional Source Beutler Lab
Gene Symbol Tbx20
Ensembl Gene ENSMUSG00000031965
Gene Name T-box 20
Synonyms Tbx12, 9430010M06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8110 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 24718138-24774303 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 24725525 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 422 (Y422F)
Ref Sequence ENSEMBL: ENSMUSP00000052591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052946]
AlphaFold Q9ES03
Predicted Effect probably damaging
Transcript: ENSMUST00000052946
AA Change: Y422F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052591
Gene: ENSMUSG00000031965
AA Change: Y422F

DomainStartEndE-ValueType
low complexity region 68 78 N/A INTRINSIC
low complexity region 81 95 N/A INTRINSIC
TBOX 98 292 1.08e-122 SMART
low complexity region 339 353 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.1%
Validation Efficiency 99% (73/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a T-box family member. The T-box family members share a common DNA binding domain, termed the T-box, and they are transcription factors involved in the regulation of developmental processes. This gene is essential for heart development. Mutations in this gene are associated with diverse cardiac pathologies, including defects in septation, valvulogenesis and cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice display embryonic lethality, impaired cardiac looping, a small hourglass shaped heart, and decreased cardiomyocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G T 11: 23,576,764 T696N probably benign Het
Ankrd45 T C 1: 161,151,319 probably null Het
Appl1 C A 14: 26,927,794 G592* probably null Het
Arfgef2 T A 2: 166,878,544 M1501K probably benign Het
Calcrl C T 2: 84,339,339 A333T probably damaging Het
Cd200r3 T A 16: 44,951,472 I33N probably benign Het
Ceacam15 A G 7: 16,673,409 L61P probably benign Het
Cfap69 T A 5: 5,582,515 H827L possibly damaging Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Cyp2u1 G A 3: 131,293,654 T426I probably damaging Het
Eefsec A C 6: 88,376,330 I119S probably damaging Het
Fem1b T C 9: 62,796,268 N570S probably damaging Het
Fmo9 A G 1: 166,663,526 M461T probably benign Het
Fryl A G 5: 73,133,277 Y95H probably benign Het
Fsip2 T C 2: 82,958,673 I346T probably benign Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gabbr1 G C 17: 37,048,583 S150T probably benign Het
Galnt9 G T 5: 110,615,473 W448L probably damaging Het
Gcnt2 G T 13: 40,917,722 probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm17727 T C 9: 35,778,033 *84W probably null Het
Gm8882 C T 6: 132,361,568 G229D unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd4 A G 5: 121,332,949 Y2633C possibly damaging Het
Hsd11b2 A G 8: 105,522,634 I214V probably damaging Het
Hspa12a T A 19: 58,821,013 E217V possibly damaging Het
Itih2 A G 2: 10,097,137 F845L probably damaging Het
Kcnn3 T A 3: 89,661,233 L606H probably damaging Het
Krt6b G A 15: 101,680,142 R28C probably damaging Het
Lama2 T A 10: 26,990,870 D2876V probably damaging Het
Lmbrd2 T C 15: 9,175,192 S397P probably damaging Het
Lmf2 C T 15: 89,352,358 probably null Het
Lrp2 A G 2: 69,506,453 I1325T probably benign Het
Ltbp2 A T 12: 84,803,902 C879* probably null Het
Map3k1 A G 13: 111,755,313 V1136A probably damaging Het
Mettl3 G T 14: 52,300,252 H84N probably benign Het
Mia2 A G 12: 59,109,087 probably null Het
Mlip G T 9: 77,239,579 T92K probably damaging Het
Nalcn T A 14: 123,464,701 Y466F probably benign Het
Nav2 T A 7: 49,551,950 L235* probably null Het
Nbn T C 4: 15,981,588 V560A probably benign Het
Ncln A T 10: 81,493,153 Y144N possibly damaging Het
Nfe2l2 A C 2: 75,679,421 D18E probably benign Het
Olfr102 A G 17: 37,313,713 F224L probably benign Het
Olfr1131 T C 2: 87,628,607 I48T possibly damaging Het
Olfr356 T C 2: 36,937,709 C197R possibly damaging Het
Olfr432 G A 1: 174,050,525 A51T probably benign Het
Otop3 A T 11: 115,339,395 M33L probably benign Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phf14 T C 6: 11,953,423 I387T possibly damaging Het
Prdm9 T A 17: 15,554,698 N318Y probably damaging Het
Proca1 A G 11: 78,204,911 D123G probably damaging Het
Prune2 G A 19: 17,120,719 G1196S probably benign Het
Psd3 T A 8: 68,121,056 S158C probably damaging Het
Rps18 A G 17: 33,955,136 V15A probably benign Het
Sharpin C A 15: 76,347,765 R271L possibly damaging Het
Smad5 C A 13: 56,723,888 Q99K probably damaging Het
Sox5 T C 6: 144,116,474 M151V possibly damaging Het
Sphkap A T 1: 83,278,771 F419Y possibly damaging Het
Tcirg1 A C 19: 3,899,099 F397V probably damaging Het
Tex36 G A 7: 133,595,283 S35F possibly damaging Het
Tsen54 G T 11: 115,814,934 A26S unknown Het
Usp50 T A 2: 126,780,330 probably null Het
Vmn2r5 A T 3: 64,491,288 F757I probably benign Het
Zbbx T C 3: 75,155,442 T3A possibly damaging Het
Zfp28 T A 7: 6,389,829 M168K probably benign Het
Zfp568 G T 7: 30,023,126 G499W probably damaging Het
Zfp7 C G 15: 76,890,931 P391R possibly damaging Het
Other mutations in Tbx20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Tbx20 APN 9 24758748 missense probably damaging 1.00
IGL00572:Tbx20 APN 9 24725688 missense probably benign
IGL01016:Tbx20 APN 9 24750321 missense probably damaging 1.00
IGL01317:Tbx20 APN 9 24769755 missense probably damaging 1.00
IGL02643:Tbx20 APN 9 24773713 unclassified probably benign
IGL02690:Tbx20 APN 9 24773737 missense probably benign 0.27
BB006:Tbx20 UTSW 9 24725763 missense possibly damaging 0.86
BB016:Tbx20 UTSW 9 24725763 missense possibly damaging 0.86
R0853:Tbx20 UTSW 9 24725612 missense probably benign 0.05
R0855:Tbx20 UTSW 9 24725612 missense probably benign 0.05
R0856:Tbx20 UTSW 9 24725612 missense probably benign 0.05
R1781:Tbx20 UTSW 9 24725499 missense probably benign 0.00
R1840:Tbx20 UTSW 9 24725676 missense probably benign 0.22
R1981:Tbx20 UTSW 9 24770913 missense possibly damaging 0.85
R2063:Tbx20 UTSW 9 24769771 nonsense probably null
R2357:Tbx20 UTSW 9 24769776 missense possibly damaging 0.56
R4166:Tbx20 UTSW 9 24769744 missense probably damaging 1.00
R4790:Tbx20 UTSW 9 24725714 missense probably benign 0.34
R4904:Tbx20 UTSW 9 24758833 missense probably damaging 0.98
R5436:Tbx20 UTSW 9 24769720 missense probably damaging 1.00
R5799:Tbx20 UTSW 9 24725520 nonsense probably null
R5898:Tbx20 UTSW 9 24758859 missense probably damaging 1.00
R6914:Tbx20 UTSW 9 24725483 missense probably benign 0.19
R6962:Tbx20 UTSW 9 24769740 missense probably damaging 1.00
R7556:Tbx20 UTSW 9 24750277 splice site probably null
R7731:Tbx20 UTSW 9 24770697 missense probably damaging 1.00
R7741:Tbx20 UTSW 9 24740285 splice site probably null
R7832:Tbx20 UTSW 9 24773812 missense probably damaging 1.00
R7929:Tbx20 UTSW 9 24725763 missense possibly damaging 0.86
R7982:Tbx20 UTSW 9 24773924 unclassified probably benign
R8974:Tbx20 UTSW 9 24769786 missense probably damaging 1.00
R9058:Tbx20 UTSW 9 24769723 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTGTTTCCTGGAGAGTC -3'
(R):5'- CCTGGATTTCAGCATCCACAG -3'

Sequencing Primer
(F):5'- GGAGAGTCCTTGCTCCAATAC -3'
(R):5'- AGCCCCTGACTGCTCTTGG -3'
Posted On 2020-06-30