Mutagenetix > Incidental Mutations

Incidental Mutation 'R8110:Tbx20'

630813

Institutional Source

Beutler Lab

Gene Symbol

Tbx20

Ensembl Gene

ENSMUSG00000031965

Gene Name

T-box 20

Synonyms

Tbx12, 9430010M06Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8110 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

24718138-24774303 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 24725525 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 422 (Y422F)

Ref Sequence

ENSEMBL: ENSMUSP00000052591 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052946]

AlphaFold

Q9ES03

Predicted Effect

probably damaging
Transcript: ENSMUST00000052946
AA Change: Y422F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000052591
Gene: ENSMUSG00000031965
AA Change: Y422F

Domain	Start	End	E-Value	Type
low complexity region	68	78	N/A	INTRINSIC
low complexity region	81	95	N/A	INTRINSIC
TBOX	98	292	1.08e-122	SMART
low complexity region	339	353	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 93.1%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a T-box family member. The T-box family members share a common DNA binding domain, termed the T-box, and they are transcription factors involved in the regulation of developmental processes. This gene is essential for heart development. Mutations in this gene are associated with diverse cardiac pathologies, including defects in septation, valvulogenesis and cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice display embryonic lethality, impaired cardiac looping, a small hourglass shaped heart, and decreased cardiomyocyte proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	G	T	11: 23,576,764	T696N	probably benign	Het
Ankrd45	T	C	1: 161,151,319		probably null	Het
Appl1	C	A	14: 26,927,794	G592*	probably null	Het
Arfgef2	T	A	2: 166,878,544	M1501K	probably benign	Het
Calcrl	C	T	2: 84,339,339	A333T	probably damaging	Het
Cd200r3	T	A	16: 44,951,472	I33N	probably benign	Het
Ceacam15	A	G	7: 16,673,409	L61P	probably benign	Het
Cfap69	T	A	5: 5,582,515	H827L	possibly damaging	Het
Csmd3	T	A	15: 47,644,270	E2780V	probably damaging	Het
Cyp2u1	G	A	3: 131,293,654	T426I	probably damaging	Het
Eefsec	A	C	6: 88,376,330	I119S	probably damaging	Het
Fem1b	T	C	9: 62,796,268	N570S	probably damaging	Het
Fmo9	A	G	1: 166,663,526	M461T	probably benign	Het
Fryl	A	G	5: 73,133,277	Y95H	probably benign	Het
Fsip2	T	C	2: 82,958,673	I346T	probably benign	Het
Fto	T	C	8: 91,485,190	F381S	probably damaging	Het
Gabbr1	G	C	17: 37,048,583	S150T	probably benign	Het
Galnt9	G	T	5: 110,615,473	W448L	probably damaging	Het
Gcnt2	G	T	13: 40,917,722		probably benign	Het
Gm10800	CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA	CAAGAAAACTGAAAATCA	2: 98,667,016		probably null	Het
Gm17727	T	C	9: 35,778,033	*84W	probably null	Het
Gm8882	C	T	6: 132,361,568	G229D	unknown	Het
Gmcl1	G	T	6: 86,721,426	A163E	probably damaging	Het
Hectd4	A	G	5: 121,332,949	Y2633C	possibly damaging	Het
Hsd11b2	A	G	8: 105,522,634	I214V	probably damaging	Het
Hspa12a	T	A	19: 58,821,013	E217V	possibly damaging	Het
Itih2	A	G	2: 10,097,137	F845L	probably damaging	Het
Kcnn3	T	A	3: 89,661,233	L606H	probably damaging	Het
Krt6b	G	A	15: 101,680,142	R28C	probably damaging	Het
Lama2	T	A	10: 26,990,870	D2876V	probably damaging	Het
Lmbrd2	T	C	15: 9,175,192	S397P	probably damaging	Het
Lmf2	C	T	15: 89,352,358		probably null	Het
Lrp2	A	G	2: 69,506,453	I1325T	probably benign	Het
Ltbp2	A	T	12: 84,803,902	C879*	probably null	Het
Map3k1	A	G	13: 111,755,313	V1136A	probably damaging	Het
Mettl3	G	T	14: 52,300,252	H84N	probably benign	Het
Mia2	A	G	12: 59,109,087		probably null	Het
Mlip	G	T	9: 77,239,579	T92K	probably damaging	Het
Nalcn	T	A	14: 123,464,701	Y466F	probably benign	Het
Nav2	T	A	7: 49,551,950	L235*	probably null	Het
Nbn	T	C	4: 15,981,588	V560A	probably benign	Het
Ncln	A	T	10: 81,493,153	Y144N	possibly damaging	Het
Nfe2l2	A	C	2: 75,679,421	D18E	probably benign	Het
Olfr102	A	G	17: 37,313,713	F224L	probably benign	Het
Olfr1131	T	C	2: 87,628,607	I48T	possibly damaging	Het
Olfr356	T	C	2: 36,937,709	C197R	possibly damaging	Het
Olfr432	G	A	1: 174,050,525	A51T	probably benign	Het
Otop3	A	T	11: 115,339,395	M33L	probably benign	Het
Pdzd2	G	A	15: 12,373,506	S2181L	probably benign	Het
Phf14	T	C	6: 11,953,423	I387T	possibly damaging	Het
Prdm9	T	A	17: 15,554,698	N318Y	probably damaging	Het
Proca1	A	G	11: 78,204,911	D123G	probably damaging	Het
Prune2	G	A	19: 17,120,719	G1196S	probably benign	Het
Psd3	T	A	8: 68,121,056	S158C	probably damaging	Het
Rps18	A	G	17: 33,955,136	V15A	probably benign	Het
Sharpin	C	A	15: 76,347,765	R271L	possibly damaging	Het
Smad5	C	A	13: 56,723,888	Q99K	probably damaging	Het
Sox5	T	C	6: 144,116,474	M151V	possibly damaging	Het
Sphkap	A	T	1: 83,278,771	F419Y	possibly damaging	Het
Tcirg1	A	C	19: 3,899,099	F397V	probably damaging	Het
Tex36	G	A	7: 133,595,283	S35F	possibly damaging	Het
Tsen54	G	T	11: 115,814,934	A26S	unknown	Het
Usp50	T	A	2: 126,780,330		probably null	Het
Vmn2r5	A	T	3: 64,491,288	F757I	probably benign	Het
Zbbx	T	C	3: 75,155,442	T3A	possibly damaging	Het
Zfp28	T	A	7: 6,389,829	M168K	probably benign	Het
Zfp568	G	T	7: 30,023,126	G499W	probably damaging	Het
Zfp7	C	G	15: 76,890,931	P391R	possibly damaging	Het

Other mutations in Tbx20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Tbx20	APN	9	24758748	missense	probably damaging	1.00
IGL00572:Tbx20	APN	9	24725688	missense	probably benign
IGL01016:Tbx20	APN	9	24750321	missense	probably damaging	1.00
IGL01317:Tbx20	APN	9	24769755	missense	probably damaging	1.00
IGL02643:Tbx20	APN	9	24773713	unclassified	probably benign
IGL02690:Tbx20	APN	9	24773737	missense	probably benign	0.27
BB006:Tbx20	UTSW	9	24725763	missense	possibly damaging	0.86
BB016:Tbx20	UTSW	9	24725763	missense	possibly damaging	0.86
R0853:Tbx20	UTSW	9	24725612	missense	probably benign	0.05
R0855:Tbx20	UTSW	9	24725612	missense	probably benign	0.05
R0856:Tbx20	UTSW	9	24725612	missense	probably benign	0.05
R1781:Tbx20	UTSW	9	24725499	missense	probably benign	0.00
R1840:Tbx20	UTSW	9	24725676	missense	probably benign	0.22
R1981:Tbx20	UTSW	9	24770913	missense	possibly damaging	0.85
R2063:Tbx20	UTSW	9	24769771	nonsense	probably null
R2357:Tbx20	UTSW	9	24769776	missense	possibly damaging	0.56
R4166:Tbx20	UTSW	9	24769744	missense	probably damaging	1.00
R4790:Tbx20	UTSW	9	24725714	missense	probably benign	0.34
R4904:Tbx20	UTSW	9	24758833	missense	probably damaging	0.98
R5436:Tbx20	UTSW	9	24769720	missense	probably damaging	1.00
R5799:Tbx20	UTSW	9	24725520	nonsense	probably null
R5898:Tbx20	UTSW	9	24758859	missense	probably damaging	1.00
R6914:Tbx20	UTSW	9	24725483	missense	probably benign	0.19
R6962:Tbx20	UTSW	9	24769740	missense	probably damaging	1.00
R7556:Tbx20	UTSW	9	24750277	splice site	probably null
R7731:Tbx20	UTSW	9	24770697	missense	probably damaging	1.00
R7741:Tbx20	UTSW	9	24740285	splice site	probably null
R7832:Tbx20	UTSW	9	24773812	missense	probably damaging	1.00
R7929:Tbx20	UTSW	9	24725763	missense	possibly damaging	0.86
R7982:Tbx20	UTSW	9	24773924	unclassified	probably benign
R8974:Tbx20	UTSW	9	24769786	missense	probably damaging	1.00
R9058:Tbx20	UTSW	9	24769723	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGTGTTTCCTGGAGAGTC -3'
(R):5'- CCTGGATTTCAGCATCCACAG -3'

Sequencing Primer
(F):5'- GGAGAGTCCTTGCTCCAATAC -3'
(R):5'- AGCCCCTGACTGCTCTTGG -3'

Posted On

2020-06-30