Incidental Mutation 'R8110:Mlip'
ID 630816
Institutional Source Beutler Lab
Gene Symbol Mlip
Ensembl Gene ENSMUSG00000032355
Gene Name muscular LMNA-interacting protein
Synonyms 2310046A06Rik, CIP, cardiac ISL1-interacting protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock # R8110 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 77102081-77352969 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 77239579 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 92 (T92K)
Ref Sequence ENSEMBL: ENSMUSP00000034910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034910] [ENSMUST00000183955] [ENSMUST00000184006] [ENSMUST00000184138] [ENSMUST00000184316] [ENSMUST00000184322] [ENSMUST00000184415] [ENSMUST00000184848] [ENSMUST00000185039] [ENSMUST00000185144]
AlphaFold Q5FW52
Predicted Effect probably damaging
Transcript: ENSMUST00000034910
AA Change: T92K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034910
Gene: ENSMUSG00000032355
AA Change: T92K

DomainStartEndE-ValueType
Pfam:MLIP 69 155 1.3e-24 PFAM
Pfam:MLIP 175 269 1.9e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183955
AA Change: T136K

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138864
Gene: ENSMUSG00000032355
AA Change: T136K

DomainStartEndE-ValueType
Pfam:MLIP 111 210 7.6e-37 PFAM
low complexity region 351 363 N/A INTRINSIC
low complexity region 375 387 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
low complexity region 437 455 N/A INTRINSIC
low complexity region 528 541 N/A INTRINSIC
low complexity region 636 651 N/A INTRINSIC
Pfam:MLIP 654 881 8.5e-103 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184006
AA Change: T92K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139002
Gene: ENSMUSG00000032355
AA Change: T92K

DomainStartEndE-ValueType
Pfam:MLIP 67 154 1.5e-37 PFAM
Pfam:MLIP 175 270 1e-53 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184138
AA Change: T92K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139188
Gene: ENSMUSG00000032355
AA Change: T92K

DomainStartEndE-ValueType
Pfam:MLIP 67 157 3e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184316
AA Change: T136K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138938
Gene: ENSMUSG00000032355
AA Change: T136K

DomainStartEndE-ValueType
Pfam:MLIP 111 200 5.7e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184322
AA Change: T84K

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139055
Gene: ENSMUSG00000032355
AA Change: T84K

DomainStartEndE-ValueType
Pfam:MLIP 59 149 5.3e-37 PFAM
low complexity region 274 286 N/A INTRINSIC
low complexity region 298 310 N/A INTRINSIC
low complexity region 342 353 N/A INTRINSIC
low complexity region 360 378 N/A INTRINSIC
low complexity region 451 464 N/A INTRINSIC
low complexity region 559 574 N/A INTRINSIC
Pfam:MLIP 577 683 5.8e-23 PFAM
Pfam:MLIP 681 775 6.5e-53 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184415
AA Change: T144K

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139251
Gene: ENSMUSG00000032355
AA Change: T144K

DomainStartEndE-ValueType
Pfam:MLIP 119 374 1.1e-144 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000184848
AA Change: T92K

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139242
Gene: ENSMUSG00000032355
AA Change: T92K

DomainStartEndE-ValueType
Pfam:MLIP 67 154 3.7e-38 PFAM
Pfam:MLIP 153 227 5.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185039
AA Change: T144K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139109
Gene: ENSMUSG00000032355
AA Change: T144K

DomainStartEndE-ValueType
Pfam:MLIP 119 207 3.9e-38 PFAM
Pfam:MLIP 205 279 6.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185144
AA Change: T92K

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139362
Gene: ENSMUSG00000032355
AA Change: T92K

DomainStartEndE-ValueType
Pfam:MLIP 67 166 6.3e-37 PFAM
low complexity region 307 319 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 375 386 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
low complexity region 484 497 N/A INTRINSIC
low complexity region 592 607 N/A INTRINSIC
Pfam:MLIP 609 836 4.7e-102 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.1%
Validation Efficiency 99% (73/74)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display increased cardiac sensitivity to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G T 11: 23,576,764 T696N probably benign Het
Ankrd45 T C 1: 161,151,319 probably null Het
Appl1 C A 14: 26,927,794 G592* probably null Het
Arfgef2 T A 2: 166,878,544 M1501K probably benign Het
Calcrl C T 2: 84,339,339 A333T probably damaging Het
Cd200r3 T A 16: 44,951,472 I33N probably benign Het
Ceacam15 A G 7: 16,673,409 L61P probably benign Het
Cfap69 T A 5: 5,582,515 H827L possibly damaging Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Cyp2u1 G A 3: 131,293,654 T426I probably damaging Het
Eefsec A C 6: 88,376,330 I119S probably damaging Het
Fem1b T C 9: 62,796,268 N570S probably damaging Het
Fmo9 A G 1: 166,663,526 M461T probably benign Het
Fryl A G 5: 73,133,277 Y95H probably benign Het
Fsip2 T C 2: 82,958,673 I346T probably benign Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Gabbr1 G C 17: 37,048,583 S150T probably benign Het
Galnt9 G T 5: 110,615,473 W448L probably damaging Het
Gcnt2 G T 13: 40,917,722 probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm17727 T C 9: 35,778,033 *84W probably null Het
Gm8882 C T 6: 132,361,568 G229D unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd4 A G 5: 121,332,949 Y2633C possibly damaging Het
Hsd11b2 A G 8: 105,522,634 I214V probably damaging Het
Hspa12a T A 19: 58,821,013 E217V possibly damaging Het
Itih2 A G 2: 10,097,137 F845L probably damaging Het
Kcnn3 T A 3: 89,661,233 L606H probably damaging Het
Krt6b G A 15: 101,680,142 R28C probably damaging Het
Lama2 T A 10: 26,990,870 D2876V probably damaging Het
Lmbrd2 T C 15: 9,175,192 S397P probably damaging Het
Lmf2 C T 15: 89,352,358 probably null Het
Lrp2 A G 2: 69,506,453 I1325T probably benign Het
Ltbp2 A T 12: 84,803,902 C879* probably null Het
Map3k1 A G 13: 111,755,313 V1136A probably damaging Het
Mettl3 G T 14: 52,300,252 H84N probably benign Het
Mia2 A G 12: 59,109,087 probably null Het
Nalcn T A 14: 123,464,701 Y466F probably benign Het
Nav2 T A 7: 49,551,950 L235* probably null Het
Nbn T C 4: 15,981,588 V560A probably benign Het
Ncln A T 10: 81,493,153 Y144N possibly damaging Het
Nfe2l2 A C 2: 75,679,421 D18E probably benign Het
Olfr102 A G 17: 37,313,713 F224L probably benign Het
Olfr1131 T C 2: 87,628,607 I48T possibly damaging Het
Olfr356 T C 2: 36,937,709 C197R possibly damaging Het
Olfr432 G A 1: 174,050,525 A51T probably benign Het
Otop3 A T 11: 115,339,395 M33L probably benign Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phf14 T C 6: 11,953,423 I387T possibly damaging Het
Prdm9 T A 17: 15,554,698 N318Y probably damaging Het
Proca1 A G 11: 78,204,911 D123G probably damaging Het
Prune2 G A 19: 17,120,719 G1196S probably benign Het
Psd3 T A 8: 68,121,056 S158C probably damaging Het
Rps18 A G 17: 33,955,136 V15A probably benign Het
Sharpin C A 15: 76,347,765 R271L possibly damaging Het
Smad5 C A 13: 56,723,888 Q99K probably damaging Het
Sox5 T C 6: 144,116,474 M151V possibly damaging Het
Sphkap A T 1: 83,278,771 F419Y possibly damaging Het
Tbx20 T A 9: 24,725,525 Y422F probably damaging Het
Tcirg1 A C 19: 3,899,099 F397V probably damaging Het
Tex36 G A 7: 133,595,283 S35F possibly damaging Het
Tsen54 G T 11: 115,814,934 A26S unknown Het
Usp50 T A 2: 126,780,330 probably null Het
Vmn2r5 A T 3: 64,491,288 F757I probably benign Het
Zbbx T C 3: 75,155,442 T3A possibly damaging Het
Zfp28 T A 7: 6,389,829 M168K probably benign Het
Zfp568 G T 7: 30,023,126 G499W probably damaging Het
Zfp7 C G 15: 76,890,931 P391R possibly damaging Het
Other mutations in Mlip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Mlip APN 9 77239417 missense possibly damaging 0.89
IGL01727:Mlip APN 9 77239748 missense probably damaging 0.99
IGL01918:Mlip APN 9 77173999 missense probably damaging 1.00
IGL02079:Mlip APN 9 77239529 missense possibly damaging 0.71
IGL02561:Mlip APN 9 77181351 critical splice donor site probably null
R0393:Mlip UTSW 9 77239577 missense probably benign 0.02
R2091:Mlip UTSW 9 77164863 missense possibly damaging 0.58
R3725:Mlip UTSW 9 77190380 missense probably damaging 1.00
R5334:Mlip UTSW 9 77243676 missense probably damaging 1.00
R5591:Mlip UTSW 9 77230482 missense probably damaging 0.96
R5592:Mlip UTSW 9 77230482 missense probably damaging 0.96
R5686:Mlip UTSW 9 77347693 critical splice donor site probably null
R5820:Mlip UTSW 9 77230482 missense probably damaging 0.96
R6125:Mlip UTSW 9 77230482 missense probably damaging 0.96
R6187:Mlip UTSW 9 77230482 missense probably damaging 0.96
R6803:Mlip UTSW 9 77190381 missense probably damaging 0.99
R6860:Mlip UTSW 9 77102393 makesense probably null
R7031:Mlip UTSW 9 77138553 missense probably benign 0.03
R7206:Mlip UTSW 9 77164862 missense probably damaging 0.96
R7326:Mlip UTSW 9 77164842 missense probably benign 0.24
R7506:Mlip UTSW 9 77164803 missense probably damaging 1.00
R7509:Mlip UTSW 9 77181396 missense probably damaging 0.99
R7563:Mlip UTSW 9 77112997 missense probably damaging 0.99
R7590:Mlip UTSW 9 77230043 missense probably benign 0.15
R7615:Mlip UTSW 9 77230483 missense probably damaging 1.00
R7664:Mlip UTSW 9 77138546 missense possibly damaging 0.90
R7755:Mlip UTSW 9 77229556 missense probably benign 0.30
R8432:Mlip UTSW 9 77190729 missense possibly damaging 0.91
R9091:Mlip UTSW 9 77229798 missense probably benign 0.00
R9148:Mlip UTSW 9 77138412 missense possibly damaging 0.89
R9270:Mlip UTSW 9 77229798 missense probably benign 0.00
R9312:Mlip UTSW 9 77239778 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTTTGCTGAGGGGCTATCC -3'
(R):5'- TCTACATCTGTTGCAGTTTGAGTAC -3'

Sequencing Primer
(F):5'- TCCCATGAGGAATTTCAGGATG -3'
(R):5'- CATATGACCTTCAGCTCTGAGAG -3'
Posted On 2020-06-30