Mutagenetix > Incidental Mutations

Incidental Mutation 'R8110:Gcnt2'

630824

Institutional Source

Beutler Lab

Gene Symbol

Gcnt2

Ensembl Gene

ENSMUSG00000021360

Gene Name

glucosaminyl (N-acetyl) transferase 2, I-branching enzyme

Synonyms

IGnTB, IGnT, IGnTA, IGnTC, 5330430K10Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R8110 (G1)

Quality Score

110.008

Status

Validated

Chromosome

Chromosomal Location

40859754-40960892 bp(+) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

G to T at 40917722 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000153207 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067778] [ENSMUST00000069958] [ENSMUST00000110191] [ENSMUST00000225759]

AlphaFold

P97402

Predicted Effect

probably benign
Transcript: ENSMUST00000067778

SMART Domains

Protein: ENSMUSP00000066467
Gene: ENSMUSG00000021360

Domain	Start	End	E-Value	Type
transmembrane domain	7	26	N/A	INTRINSIC
Pfam:Branch	95	357	4.2e-58	PFAM
low complexity region	377	386	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000069958

SMART Domains

Protein: ENSMUSP00000070942
Gene: ENSMUSG00000021360

Domain	Start	End	E-Value	Type
low complexity region	8	21	N/A	INTRINSIC
Pfam:Branch	95	357	8.4e-60	PFAM
low complexity region	377	386	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110191

SMART Domains

Protein: ENSMUSP00000105820
Gene: ENSMUSG00000021360

Domain	Start	End	E-Value	Type
transmembrane domain	7	24	N/A	INTRINSIC
Pfam:Branch	95	357	5.2e-61	PFAM
low complexity region	377	386	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000225759

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 93.1%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for formation of the blood group I antigen. The i and I antigens are distinguished by linear and branched poly-N-acetyllactosaminoglycans, respectively. The encoded protein is the I-branching enzyme, a beta-1,6-N-acetylglucosaminyltransferase responsible for the conversion of fetal i antigen to adult I antigen in erythrocytes during embryonic development. Mutations in this gene have been associated with adult i blood group phenotype. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show hypoactivity, a reduced B cell number, epidermoid cyst formation in male abdominal skin, and impaired renal function with increased blood urea nitrogen and creatinine levels and vacuolization of renal tubular epithelial cells in aging mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	G	T	11: 23,576,764	T696N	probably benign	Het
Ankrd45	T	C	1: 161,151,319		probably null	Het
Appl1	C	A	14: 26,927,794	G592*	probably null	Het
Arfgef2	T	A	2: 166,878,544	M1501K	probably benign	Het
Calcrl	C	T	2: 84,339,339	A333T	probably damaging	Het
Cd200r3	T	A	16: 44,951,472	I33N	probably benign	Het
Ceacam15	A	G	7: 16,673,409	L61P	probably benign	Het
Cfap69	T	A	5: 5,582,515	H827L	possibly damaging	Het
Csmd3	T	A	15: 47,644,270	E2780V	probably damaging	Het
Cyp2u1	G	A	3: 131,293,654	T426I	probably damaging	Het
Eefsec	A	C	6: 88,376,330	I119S	probably damaging	Het
Fem1b	T	C	9: 62,796,268	N570S	probably damaging	Het
Fmo9	A	G	1: 166,663,526	M461T	probably benign	Het
Fryl	A	G	5: 73,133,277	Y95H	probably benign	Het
Fsip2	T	C	2: 82,958,673	I346T	probably benign	Het
Fto	T	C	8: 91,485,190	F381S	probably damaging	Het
Gabbr1	G	C	17: 37,048,583	S150T	probably benign	Het
Galnt9	G	T	5: 110,615,473	W448L	probably damaging	Het
Gm10800	CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA	CAAGAAAACTGAAAATCA	2: 98,667,016		probably null	Het
Gm17727	T	C	9: 35,778,033	*84W	probably null	Het
Gm8882	C	T	6: 132,361,568	G229D	unknown	Het
Gmcl1	G	T	6: 86,721,426	A163E	probably damaging	Het
Hectd4	A	G	5: 121,332,949	Y2633C	possibly damaging	Het
Hsd11b2	A	G	8: 105,522,634	I214V	probably damaging	Het
Hspa12a	T	A	19: 58,821,013	E217V	possibly damaging	Het
Itih2	A	G	2: 10,097,137	F845L	probably damaging	Het
Kcnn3	T	A	3: 89,661,233	L606H	probably damaging	Het
Krt6b	G	A	15: 101,680,142	R28C	probably damaging	Het
Lama2	T	A	10: 26,990,870	D2876V	probably damaging	Het
Lmbrd2	T	C	15: 9,175,192	S397P	probably damaging	Het
Lmf2	C	T	15: 89,352,358		probably null	Het
Lrp2	A	G	2: 69,506,453	I1325T	probably benign	Het
Ltbp2	A	T	12: 84,803,902	C879*	probably null	Het
Map3k1	A	G	13: 111,755,313	V1136A	probably damaging	Het
Mettl3	G	T	14: 52,300,252	H84N	probably benign	Het
Mia2	A	G	12: 59,109,087		probably null	Het
Mlip	G	T	9: 77,239,579	T92K	probably damaging	Het
Nalcn	T	A	14: 123,464,701	Y466F	probably benign	Het
Nav2	T	A	7: 49,551,950	L235*	probably null	Het
Nbn	T	C	4: 15,981,588	V560A	probably benign	Het
Ncln	A	T	10: 81,493,153	Y144N	possibly damaging	Het
Nfe2l2	A	C	2: 75,679,421	D18E	probably benign	Het
Olfr102	A	G	17: 37,313,713	F224L	probably benign	Het
Olfr1131	T	C	2: 87,628,607	I48T	possibly damaging	Het
Olfr356	T	C	2: 36,937,709	C197R	possibly damaging	Het
Olfr432	G	A	1: 174,050,525	A51T	probably benign	Het
Otop3	A	T	11: 115,339,395	M33L	probably benign	Het
Pdzd2	G	A	15: 12,373,506	S2181L	probably benign	Het
Phf14	T	C	6: 11,953,423	I387T	possibly damaging	Het
Prdm9	T	A	17: 15,554,698	N318Y	probably damaging	Het
Proca1	A	G	11: 78,204,911	D123G	probably damaging	Het
Prune2	G	A	19: 17,120,719	G1196S	probably benign	Het
Psd3	T	A	8: 68,121,056	S158C	probably damaging	Het
Rps18	A	G	17: 33,955,136	V15A	probably benign	Het
Sharpin	C	A	15: 76,347,765	R271L	possibly damaging	Het
Smad5	C	A	13: 56,723,888	Q99K	probably damaging	Het
Sox5	T	C	6: 144,116,474	M151V	possibly damaging	Het
Sphkap	A	T	1: 83,278,771	F419Y	possibly damaging	Het
Tbx20	T	A	9: 24,725,525	Y422F	probably damaging	Het
Tcirg1	A	C	19: 3,899,099	F397V	probably damaging	Het
Tex36	G	A	7: 133,595,283	S35F	possibly damaging	Het
Tsen54	G	T	11: 115,814,934	A26S	unknown	Het
Usp50	T	A	2: 126,780,330		probably null	Het
Vmn2r5	A	T	3: 64,491,288	F757I	probably benign	Het
Zbbx	T	C	3: 75,155,442	T3A	possibly damaging	Het
Zfp28	T	A	7: 6,389,829	M168K	probably benign	Het
Zfp568	G	T	7: 30,023,126	G499W	probably damaging	Het
Zfp7	C	G	15: 76,890,931	P391R	possibly damaging	Het

Other mutations in Gcnt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01523:Gcnt2	APN	13	40887863	missense	probably benign	0.06
IGL01693:Gcnt2	APN	13	40888073	missense	probably benign
IGL02506:Gcnt2	APN	13	40887380	missense	probably benign	0.02
IGL03184:Gcnt2	APN	13	40888184	missense	probably benign	0.01
BB001:Gcnt2	UTSW	13	40918564	nonsense	probably null
BB011:Gcnt2	UTSW	13	40918564	nonsense	probably null
PIT4472001:Gcnt2	UTSW	13	40917937	missense	probably benign	0.39
R0358:Gcnt2	UTSW	13	40860853	missense	probably damaging	0.99
R0734:Gcnt2	UTSW	13	40860521	missense	probably benign	0.00
R1863:Gcnt2	UTSW	13	40861101	missense	possibly damaging	0.95
R3103:Gcnt2	UTSW	13	40918606	missense	probably benign	0.00
R3156:Gcnt2	UTSW	13	40861178	missense	probably benign	0.36
R3893:Gcnt2	UTSW	13	40860446	missense	probably benign	0.14
R4134:Gcnt2	UTSW	13	40887807	missense	probably damaging	1.00
R4135:Gcnt2	UTSW	13	40887807	missense	probably damaging	1.00
R4279:Gcnt2	UTSW	13	40888190	missense	probably benign	0.17
R4422:Gcnt2	UTSW	13	40860525	nonsense	probably null
R4599:Gcnt2	UTSW	13	40887490	missense	probably benign
R4618:Gcnt2	UTSW	13	40958194	nonsense	probably null
R4908:Gcnt2	UTSW	13	40860734	missense	probably damaging	1.00
R5123:Gcnt2	UTSW	13	40918355	missense	probably damaging	0.99
R5291:Gcnt2	UTSW	13	40918792	missense	probably damaging	1.00
R5437:Gcnt2	UTSW	13	40861176	missense	probably damaging	1.00
R5463:Gcnt2	UTSW	13	40918174	missense	possibly damaging	0.80
R5471:Gcnt2	UTSW	13	40860719	missense	probably damaging	1.00
R5472:Gcnt2	UTSW	13	40953579	missense	probably benign	0.30
R5493:Gcnt2	UTSW	13	40953600	missense	possibly damaging	0.70
R5586:Gcnt2	UTSW	13	40860953	missense	probably damaging	1.00
R5695:Gcnt2	UTSW	13	40918199	missense	probably benign	0.03
R6244:Gcnt2	UTSW	13	40861241	missense	probably damaging	1.00
R6293:Gcnt2	UTSW	13	40918697	missense	probably damaging	1.00
R7036:Gcnt2	UTSW	13	40887556	frame shift	probably null
R7077:Gcnt2	UTSW	13	40860420	missense	probably benign
R7432:Gcnt2	UTSW	13	40887212	intron	probably benign
R7474:Gcnt2	UTSW	13	40958257	missense	probably damaging	1.00
R7508:Gcnt2	UTSW	13	40887681	missense	probably benign	0.02
R7599:Gcnt2	UTSW	13	40860867	nonsense	probably null
R7678:Gcnt2	UTSW	13	40953719	missense	probably benign	0.01
R7806:Gcnt2	UTSW	13	40918241	missense	probably damaging	1.00
R7808:Gcnt2	UTSW	13	40860862	missense	possibly damaging	0.81
R7909:Gcnt2	UTSW	13	40860450	missense	probably benign	0.00
R7924:Gcnt2	UTSW	13	40918564	nonsense	probably null
R8287:Gcnt2	UTSW	13	40860632	missense	probably damaging	1.00
R8782:Gcnt2	UTSW	13	40918753	missense	probably damaging	0.98
R8956:Gcnt2	UTSW	13	40887728	missense	probably benign	0.30
R9225:Gcnt2	UTSW	13	40860860	missense	probably damaging	1.00
R9357:Gcnt2	UTSW	13	40888256	missense	possibly damaging	0.92
Z1088:Gcnt2	UTSW	13	40918639	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGGCACCTCTAGCTTTTCG -3'
(R):5'- TGACAGACGTCCTTTCGCTG -3'

Sequencing Primer
(F):5'- GTATGCAAATGAAGAGGTTTCCCCC -3'
(R):5'- GAAAACTTTCCCGCGTAGGCTC -3'

Posted On

2020-06-30