Incidental Mutation 'R8110:Prdm9'
ID630837
Institutional Source Beutler Lab
Gene Symbol Prdm9
Ensembl Gene ENSMUSG00000051977
Gene NamePR domain containing 9
SynonymsDsbc1, repro7, Rcr1, Meisetz, G1-419-29
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock #R8110 (G1)
Quality Score209.009
Status Validated
Chromosome17
Chromosomal Location15543079-15564354 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15554698 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 318 (N318Y)
Ref Sequence ENSEMBL: ENSMUSP00000131871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147532] [ENSMUST00000167994]
Predicted Effect probably damaging
Transcript: ENSMUST00000147532
AA Change: N193Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118454
Gene: ENSMUSG00000051977
AA Change: N193Y

DomainStartEndE-ValueType
Pfam:SSXRD 49 81 1.8e-19 PFAM
SET 123 243 2.56e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167994
AA Change: N318Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131871
Gene: ENSMUSG00000051977
AA Change: N318Y

DomainStartEndE-ValueType
KRAB 30 89 5.54e-8 SMART
Pfam:SSXRD 175 205 1.5e-20 PFAM
SET 248 368 2.56e-2 SMART
ZnF_C2H2 392 415 3.29e-1 SMART
ZnF_C2H2 516 535 4.74e1 SMART
ZnF_C2H2 541 563 9.73e-4 SMART
ZnF_C2H2 569 591 1.3e-4 SMART
ZnF_C2H2 597 619 1.3e-4 SMART
ZnF_C2H2 625 647 4.24e-4 SMART
ZnF_C2H2 653 675 4.24e-4 SMART
ZnF_C2H2 681 703 1.95e-3 SMART
ZnF_C2H2 709 731 5.99e-4 SMART
ZnF_C2H2 737 759 1.95e-3 SMART
ZnF_C2H2 765 787 1.95e-3 SMART
ZnF_C2H2 793 815 1.3e-4 SMART
ZnF_C2H2 821 843 1.6e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 93.1%
Validation Efficiency 57% (42/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger protein with histone methyltransferase activity that catalyzes histone H3 lysine 4 trimethylation (H3K4me3) during meiotic prophase. This protein contains multiple domains, including a Kruppel-associated box (KRAB) domain, an SSX repression domain (SSXRD), a PRD1-BF1 and RIZ homologous region, a subclass of SET (PR/SET) domain, and a tandem array of C2H2 zinc fingers. The zinc finger array recognizes a short sequence motif, leading to local H3K4me3, and meiotic recombination hotspot activity. The observed allelic variation alters the DNA-binding sequence specificity of the protein, resulting in distinct meiotic recombination hotspots amongst individuals and populations. Multiple alternate alleles of this gene have been described. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased oocyte number, azoospermia, and sterility in both sexes due to severe impairment of the double-stranded break repair pathway, deficient pairing of homologous chromosomes, and impaired sex body formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik G T 11: 23,576,764 T696N probably benign Het
Ankrd45 T C 1: 161,151,319 probably null Het
Appl1 C A 14: 26,927,794 G592* probably null Het
Arfgef2 T A 2: 166,878,544 M1501K probably benign Het
Calcrl C T 2: 84,339,339 A333T probably damaging Het
Cd200r3 T A 16: 44,951,472 I33N probably benign Het
Ceacam15 A G 7: 16,673,409 L61P probably benign Het
Cfap69 T A 5: 5,582,515 H827L possibly damaging Het
Csmd3 T A 15: 47,644,270 E2780V probably damaging Het
Cyp2u1 G A 3: 131,293,654 T426I probably damaging Het
Eefsec A C 6: 88,376,330 I119S probably damaging Het
Fem1b T C 9: 62,796,268 N570S probably damaging Het
Fmo9 A G 1: 166,663,526 M461T probably benign Het
Fryl A G 5: 73,133,277 Y95H probably benign Het
Fsip2 T C 2: 82,958,673 I346T probably benign Het
Fto T C 8: 91,485,190 F381S probably damaging Het
Fxyd2 G A 9: 45,408,375 probably null Het
Gabbr1 G C 17: 37,048,583 S150T probably benign Het
Galnt9 G T 5: 110,615,473 W448L probably damaging Het
Gcnt2 G T 13: 40,917,722 probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm17727 T C 9: 35,778,033 *84W probably null Het
Gm8882 C T 6: 132,361,568 G229D unknown Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Hectd4 A G 5: 121,332,949 Y2633C possibly damaging Het
Hsd11b2 A G 8: 105,522,634 I214V probably damaging Het
Hspa12a T A 19: 58,821,013 E217V possibly damaging Het
Itih2 A G 2: 10,097,137 F845L probably damaging Het
Kcnn3 T A 3: 89,661,233 L606H probably damaging Het
Krt6b G A 15: 101,680,142 R28C probably damaging Het
Lama2 T A 10: 26,990,870 D2876V probably damaging Het
Lmbrd2 T C 15: 9,175,192 S397P probably damaging Het
Lmf2 C T 15: 89,352,358 probably null Het
Lrp2 A G 2: 69,506,453 I1325T probably benign Het
Ltbp2 A T 12: 84,803,902 C879* probably null Het
Map3k1 A G 13: 111,755,313 V1136A probably damaging Het
Mettl3 G T 14: 52,300,252 H84N probably benign Het
Mia2 A G 12: 59,109,087 probably null Het
Mlip G T 9: 77,239,579 T92K probably damaging Het
Nalcn T A 14: 123,464,701 Y466F probably benign Het
Nav2 T A 7: 49,551,950 L235* probably null Het
Nbn T C 4: 15,981,588 V560A probably benign Het
Ncln A T 10: 81,493,153 Y144N possibly damaging Het
Nfe2l2 A C 2: 75,679,421 D18E probably benign Het
Olfr102 A G 17: 37,313,713 F224L probably benign Het
Olfr1131 T C 2: 87,628,607 I48T possibly damaging Het
Olfr356 T C 2: 36,937,709 C197R possibly damaging Het
Olfr432 G A 1: 174,050,525 A51T probably benign Het
Otop3 A T 11: 115,339,395 M33L probably benign Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Phf14 T C 6: 11,953,423 I387T possibly damaging Het
Proca1 A G 11: 78,204,911 D123G probably damaging Het
Prune2 G A 19: 17,120,719 G1196S probably benign Het
Psd3 T A 8: 68,121,056 S158C probably damaging Het
Rps18 A G 17: 33,955,136 V15A probably benign Het
Sharpin C A 15: 76,347,765 R271L possibly damaging Het
Smad5 C A 13: 56,723,888 Q99K probably damaging Het
Sox5 T C 6: 144,116,474 M151V possibly damaging Het
Sphkap A T 1: 83,278,771 F419Y possibly damaging Het
Tbx20 T A 9: 24,725,525 Y422F probably damaging Het
Tcirg1 A C 19: 3,899,099 F397V probably damaging Het
Tex36 G A 7: 133,595,283 S35F possibly damaging Het
Tsen54 G T 11: 115,814,934 A26S unknown Het
Tubb5 G A 17: 35,838,275 probably benign Het
Usp50 T A 2: 126,780,330 probably null Het
Vmn2r5 A T 3: 64,491,288 F757I probably benign Het
Zbbx T C 3: 75,155,442 T3A possibly damaging Het
Zfp28 T A 7: 6,389,829 M168K probably benign Het
Zfp568 G T 7: 30,023,126 G499W probably damaging Het
Zfp7 C G 15: 76,890,931 P391R possibly damaging Het
Other mutations in Prdm9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Prdm9 APN 17 15553346 missense probably benign 0.11
IGL02322:Prdm9 APN 17 15562848 missense probably damaging 0.99
IGL02354:Prdm9 APN 17 15562847 missense probably damaging 1.00
IGL02361:Prdm9 APN 17 15562847 missense probably damaging 1.00
IGL02724:Prdm9 APN 17 15563260 missense probably benign 0.07
IGL03120:Prdm9 APN 17 15544931 missense probably benign
berlin UTSW 17 15562440 missense probably damaging 0.96
R0173:Prdm9 UTSW 17 15544013 missense probably benign 0.02
R0173:Prdm9 UTSW 17 15544035 missense probably benign 0.00
R0309:Prdm9 UTSW 17 15557384 missense probably damaging 0.98
R1420:Prdm9 UTSW 17 15544376 missense probably damaging 1.00
R3498:Prdm9 UTSW 17 15562945 splice site probably benign
R3714:Prdm9 UTSW 17 15557361 nonsense probably null
R4118:Prdm9 UTSW 17 15544013 missense probably benign 0.02
R4369:Prdm9 UTSW 17 15544446 missense probably benign 0.14
R4691:Prdm9 UTSW 17 15553378 missense probably benign 0.03
R4742:Prdm9 UTSW 17 15553521 missense probably damaging 0.99
R4910:Prdm9 UTSW 17 15544323 missense probably benign 0.08
R5056:Prdm9 UTSW 17 15562417 missense possibly damaging 0.93
R5130:Prdm9 UTSW 17 15544467 missense probably benign 0.00
R5175:Prdm9 UTSW 17 15557451 missense probably benign 0.04
R5187:Prdm9 UTSW 17 15562893 missense probably damaging 0.98
R5213:Prdm9 UTSW 17 15555154 missense probably damaging 0.98
R5270:Prdm9 UTSW 17 15553363 missense probably benign 0.16
R5635:Prdm9 UTSW 17 15562440 missense probably damaging 0.96
R6753:Prdm9 UTSW 17 15544956 missense probably benign 0.00
R6857:Prdm9 UTSW 17 15544256 missense probably benign 0.04
R7041:Prdm9 UTSW 17 15544995 missense possibly damaging 0.56
R7355:Prdm9 UTSW 17 15545235 missense probably benign 0.01
R7410:Prdm9 UTSW 17 15544997 missense possibly damaging 0.73
R7570:Prdm9 UTSW 17 15555652 missense probably benign 0.14
R7571:Prdm9 UTSW 17 15563264 missense probably damaging 0.98
R7575:Prdm9 UTSW 17 15544628 missense probably damaging 1.00
R7593:Prdm9 UTSW 17 15544605 missense possibly damaging 0.81
R7664:Prdm9 UTSW 17 15555571 missense probably damaging 0.99
R7755:Prdm9 UTSW 17 15544964 missense probably damaging 1.00
R7817:Prdm9 UTSW 17 15559049 missense probably damaging 1.00
R7875:Prdm9 UTSW 17 15553542 nonsense probably null
R8222:Prdm9 UTSW 17 15544773 missense possibly damaging 0.93
R8405:Prdm9 UTSW 17 15544194 missense probably benign 0.22
X0021:Prdm9 UTSW 17 15553472 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCCTCAGTATTCCAATTTTGCTGAG -3'
(R):5'- CATGATGACTCAGAAGCCTCATG -3'

Sequencing Primer
(F):5'- TCCAATTTTGCTGAGTAGATTTGTAC -3'
(R):5'- TCAGAAGCCTCATGTGCGGTC -3'
Posted On2020-06-30