Incidental Mutation 'R8111:Atg9a'
ID 630845
Institutional Source Beutler Lab
Gene Symbol Atg9a
Ensembl Gene ENSMUSG00000033124
Gene Name autophagy related 9A
Synonyms Apg9l1
MMRRC Submission 067540-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8111 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 75157509-75168654 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 75164366 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 160 (I160N)
Ref Sequence ENSEMBL: ENSMUSP00000047449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040689] [ENSMUST00000127625] [ENSMUST00000145459] [ENSMUST00000152233] [ENSMUST00000186744] [ENSMUST00000188347] [ENSMUST00000189665] [ENSMUST00000189702]
AlphaFold Q68FE2
Predicted Effect probably damaging
Transcript: ENSMUST00000040689
AA Change: I160N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124
AA Change: I160N

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127625
SMART Domains Protein: ENSMUSP00000137179
Gene: ENSMUSG00000026199

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
Blast:ZnF_C2H2 96 120 1e-10 BLAST
low complexity region 143 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145459
SMART Domains Protein: ENSMUSP00000135971
Gene: ENSMUSG00000026199

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
Blast:ZnF_C2H2 96 120 1e-9 BLAST
low complexity region 143 171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152233
SMART Domains Protein: ENSMUSP00000136163
Gene: ENSMUSG00000026199

DomainStartEndE-ValueType
low complexity region 19 45 N/A INTRINSIC
Blast:ZnF_C2H2 96 120 6e-11 BLAST
low complexity region 143 171 N/A INTRINSIC
low complexity region 394 407 N/A INTRINSIC
low complexity region 425 451 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
Blast:ANK 515 545 2e-9 BLAST
ANK 556 585 6.81e-3 SMART
coiled coil region 628 681 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186744
Predicted Effect probably benign
Transcript: ENSMUST00000187785
Predicted Effect probably damaging
Transcript: ENSMUST00000188347
AA Change: I160N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124
AA Change: I160N

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189665
AA Change: I160N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124
AA Change: I160N

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000189702
AA Change: I160N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124
AA Change: I160N

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation all die within 1 day of birth and display impaired autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,382,266 (GRCm39) W1233* probably null Het
4930590J08Rik A G 6: 91,894,691 (GRCm39) I247V probably benign Het
8030423J24Rik T A 13: 71,032,077 (GRCm39) C50S unknown Het
Adam29 T G 8: 56,324,585 (GRCm39) H623P probably benign Het
Adamts5 A G 16: 85,696,203 (GRCm39) V318A probably damaging Het
Ano3 T C 2: 110,614,058 (GRCm39) D215G possibly damaging Het
Ap3b2 A G 7: 81,113,530 (GRCm39) I893T unknown Het
Apob G A 12: 8,058,801 (GRCm39) A2428T probably benign Het
Armc3 T C 2: 19,301,674 (GRCm39) V660A probably benign Het
Atf7 G T 15: 102,471,769 (GRCm39) T42K probably damaging Het
Atp2b1 T C 10: 98,832,786 (GRCm39) V429A possibly damaging Het
Bpifb3 A C 2: 153,764,609 (GRCm39) H167P probably benign Het
Cacna1f G T X: 7,487,326 (GRCm39) E921D probably damaging Het
Ccdc57 T A 11: 120,769,713 (GRCm39) L713F probably damaging Het
Chd1l C T 3: 97,494,526 (GRCm39) E385K possibly damaging Het
Csmd1 C T 8: 15,967,306 (GRCm39) V3186I probably benign Het
Dclre1c T A 2: 3,448,185 (GRCm39) D349E probably benign Het
Dlg1 C T 16: 31,661,620 (GRCm39) T657M possibly damaging Het
Dync2h1 T C 9: 7,148,688 (GRCm39) I919V probably benign Het
Dync2i2 C A 2: 29,921,859 (GRCm39) A501S possibly damaging Het
Eml5 A G 12: 98,758,773 (GRCm39) probably null Het
Epas1 C A 17: 87,125,860 (GRCm39) S286* probably null Het
Fat1 G A 8: 45,479,095 (GRCm39) V2714I possibly damaging Het
Fuca2 T C 10: 13,390,545 (GRCm39) M447T probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,497,361 (GRCm39) probably null Het
Gm11110 A C 17: 57,410,427 (GRCm39) C24G probably null Het
Gm6176 T A 7: 21,750,593 (GRCm39) I113F probably benign Het
Gmcl1 G T 6: 86,698,408 (GRCm39) A163E probably damaging Het
Gpat2 G T 2: 127,275,777 (GRCm39) L518F probably damaging Het
Gpr137b T C 13: 13,533,991 (GRCm39) Y355C Het
Hgsnat C T 8: 26,458,440 (GRCm39) V195I probably benign Het
Hivep3 T A 4: 119,955,583 (GRCm39) S1300T probably damaging Het
Hs3st2 A T 7: 120,992,362 (GRCm39) H137L probably damaging Het
Iffo1 T C 6: 125,122,781 (GRCm39) S188P possibly damaging Het
Itih1 T C 14: 30,654,225 (GRCm39) D684G probably damaging Het
Lrba C A 3: 86,235,012 (GRCm39) N852K probably damaging Het
Lrriq4 T C 3: 30,709,930 (GRCm39) S425P possibly damaging Het
Mdn1 T A 4: 32,674,003 (GRCm39) S562T possibly damaging Het
Mex3a T C 3: 88,444,064 (GRCm39) V380A probably benign Het
Mgat4d A T 8: 84,094,776 (GRCm39) N271I probably damaging Het
Mmp24 T A 2: 155,649,345 (GRCm39) V254E possibly damaging Het
Muc16 T A 9: 18,503,925 (GRCm39) R6455S possibly damaging Het
Npffr1 T A 10: 61,459,128 (GRCm39) V127E probably damaging Het
Obox5 T A 7: 15,492,541 (GRCm39) N165K probably damaging Het
Or10g3b G A 14: 52,587,344 (GRCm39) T53M possibly damaging Het
Otulin A C 15: 27,606,381 (GRCm39) V344G probably damaging Het
Pappa A G 4: 65,180,229 (GRCm39) D1030G probably damaging Het
Pdzd2 G A 15: 12,373,592 (GRCm39) S2181L probably benign Het
Ppp2r3c C A 12: 55,344,634 (GRCm39) M111I probably benign Het
Prss37 T C 6: 40,494,747 (GRCm39) T13A probably benign Het
Sfi1 TCGC TC 11: 3,096,254 (GRCm39) probably null Het
Sgo2b T A 8: 64,396,138 (GRCm39) K39N probably damaging Het
Sike1 T C 3: 102,909,123 (GRCm39) *208Q probably null Het
Spire1 A G 18: 67,652,391 (GRCm39) S229P probably damaging Het
Tmem132b A G 5: 125,699,857 (GRCm39) I132V probably benign Het
Umodl1 T C 17: 31,190,792 (GRCm39) V213A probably damaging Het
Washc1 C G 17: 66,423,033 (GRCm39) Q116E probably benign Het
Zfp553 T A 7: 126,836,093 (GRCm39) C549* probably null Het
Zfp9 G A 6: 118,441,561 (GRCm39) P367L probably damaging Het
Other mutations in Atg9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Atg9a APN 1 75,167,010 (GRCm39) missense probably damaging 1.00
IGL02041:Atg9a APN 1 75,159,748 (GRCm39) missense possibly damaging 0.47
IGL03367:Atg9a APN 1 75,164,601 (GRCm39) missense probably benign 0.18
PIT4494001:Atg9a UTSW 1 75,164,597 (GRCm39) nonsense probably null
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0408:Atg9a UTSW 1 75,161,939 (GRCm39) missense probably damaging 1.00
R0520:Atg9a UTSW 1 75,163,178 (GRCm39) nonsense probably null
R0653:Atg9a UTSW 1 75,166,972 (GRCm39) missense probably damaging 0.96
R0666:Atg9a UTSW 1 75,161,734 (GRCm39) missense probably damaging 0.99
R0961:Atg9a UTSW 1 75,163,390 (GRCm39) missense probably damaging 0.99
R1489:Atg9a UTSW 1 75,162,734 (GRCm39) missense probably damaging 1.00
R1490:Atg9a UTSW 1 75,162,389 (GRCm39) missense possibly damaging 0.70
R1692:Atg9a UTSW 1 75,166,999 (GRCm39) missense probably benign 0.04
R1997:Atg9a UTSW 1 75,166,270 (GRCm39) missense probably benign 0.33
R2005:Atg9a UTSW 1 75,162,635 (GRCm39) missense probably benign 0.18
R2172:Atg9a UTSW 1 75,162,329 (GRCm39) missense probably damaging 0.99
R4004:Atg9a UTSW 1 75,163,095 (GRCm39) missense probably damaging 1.00
R4105:Atg9a UTSW 1 75,162,603 (GRCm39) missense probably damaging 1.00
R5010:Atg9a UTSW 1 75,162,704 (GRCm39) splice site probably null
R5220:Atg9a UTSW 1 75,162,372 (GRCm39) missense probably damaging 1.00
R5898:Atg9a UTSW 1 75,162,916 (GRCm39) missense probably damaging 1.00
R6295:Atg9a UTSW 1 75,161,702 (GRCm39) missense probably benign 0.01
R6390:Atg9a UTSW 1 75,164,625 (GRCm39) missense probably damaging 1.00
R7312:Atg9a UTSW 1 75,164,736 (GRCm39) missense probably damaging 1.00
R7729:Atg9a UTSW 1 75,161,204 (GRCm39) missense probably benign 0.34
R8210:Atg9a UTSW 1 75,163,009 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,161,927 (GRCm39) missense probably damaging 1.00
R8256:Atg9a UTSW 1 75,163,563 (GRCm39) missense possibly damaging 0.88
R8319:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8321:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8382:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8406:Atg9a UTSW 1 75,167,028 (GRCm39) missense probably damaging 1.00
R8482:Atg9a UTSW 1 75,162,870 (GRCm39) missense probably damaging 0.99
R8855:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R8866:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R9381:Atg9a UTSW 1 75,162,726 (GRCm39) missense probably benign
R9441:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9442:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9448:Atg9a UTSW 1 75,162,849 (GRCm39) missense probably benign 0.35
R9608:Atg9a UTSW 1 75,161,739 (GRCm39) missense possibly damaging 0.52
R9703:Atg9a UTSW 1 75,162,431 (GRCm39) missense probably damaging 0.98
RF021:Atg9a UTSW 1 75,159,273 (GRCm39) missense probably damaging 0.96
Z1176:Atg9a UTSW 1 75,163,203 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAAGATATTTCCTGACCTGC -3'
(R):5'- ACTCTAGAACGTGTTGCTAAGAC -3'

Sequencing Primer
(F):5'- CCAATAAGGGGCTGCTCTTAG -3'
(R):5'- GAACGTGTTGCTAAGACTCCATC -3'
Posted On 2020-06-30