Incidental Mutation 'R8111:Wdr34'
ID630848
Institutional Source Beutler Lab
Gene Symbol Wdr34
Ensembl Gene ENSMUSG00000039715
Gene NameWD repeat domain 34
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R8111 (G1)
Quality Score208.009
Status Not validated
Chromosome2
Chromosomal Location30031546-30048881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 30031847 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 501 (A501S)
Ref Sequence ENSEMBL: ENSMUSP00000109340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113711] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000129241]
Predicted Effect probably benign
Transcript: ENSMUST00000046257
SMART Domains Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1635 9.65e-30 SMART
SPEC 1641 1741 2.32e-32 SMART
SPEC 1747 1847 6.98e-36 SMART
SPEC 1853 1953 1.53e-32 SMART
SPEC 1959 2060 6.23e-24 SMART
SPEC 2074 2174 2.08e-11 SMART
SPEC 2188 2289 1.07e-4 SMART
EFh 2307 2335 5.78e-7 SMART
EFh 2350 2378 3.85e-3 SMART
efhand_Ca_insen 2382 2451 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095083
SMART Domains Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1655 9.65e-30 SMART
SPEC 1661 1761 2.32e-32 SMART
SPEC 1767 1867 6.98e-36 SMART
SPEC 1873 1973 1.53e-32 SMART
SPEC 1979 2080 6.23e-24 SMART
SPEC 2094 2194 2.08e-11 SMART
SPEC 2208 2309 1.07e-4 SMART
EFh 2327 2355 5.78e-7 SMART
EFh 2370 2398 3.85e-3 SMART
efhand_Ca_insen 2402 2471 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100225
SMART Domains Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1088 1.56e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1094 1230 6.52e-27 SMART
SPEC 1236 1336 1.44e-37 SMART
SPEC 1342 1442 4.43e-29 SMART
SPEC 1448 1548 7.54e-32 SMART
SPEC 1554 1660 2.06e-24 SMART
SPEC 1666 1766 2.32e-32 SMART
SPEC 1772 1872 6.98e-36 SMART
SPEC 1878 1978 1.53e-32 SMART
SPEC 1984 2085 6.23e-24 SMART
SPEC 2099 2199 2.08e-11 SMART
SPEC 2213 2314 1.07e-4 SMART
EFh 2332 2360 5.78e-7 SMART
EFh 2375 2403 3.85e-3 SMART
efhand_Ca_insen 2407 2476 6.74e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113711
AA Change: A501S

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109340
Gene: ENSMUSG00000039715
AA Change: A501S

DomainStartEndE-ValueType
low complexity region 11 36 N/A INTRINSIC
low complexity region 90 100 N/A INTRINSIC
Blast:WD40 146 200 3e-28 BLAST
WD40 207 247 2e-1 SMART
WD40 256 300 3.42e1 SMART
Blast:WD40 323 364 8e-10 BLAST
WD40 382 422 1.66e-5 SMART
WD40 425 465 3.09e-1 SMART
WD40 470 512 4.18e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113717
SMART Domains Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2294 1.07e-4 SMART
EFh 2312 2340 5.78e-7 SMART
EFh 2355 2383 3.85e-3 SMART
efhand_Ca_insen 2387 2456 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113719
SMART Domains Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
SPEC 47 146 2.1e-30 SMART
SPEC 152 252 2.6e-35 SMART
SPEC 258 358 4.93e-36 SMART
SPEC 364 464 1.08e-27 SMART
SPEC 470 570 9.01e-30 SMART
SPEC 576 675 3.52e-32 SMART
SPEC 681 781 2.15e-36 SMART
SPEC 787 887 2.45e-40 SMART
SPEC 893 1068 1.18e-24 SMART
SH3 970 1025 8.24e-18 SMART
SPEC 1074 1210 6.52e-27 SMART
SPEC 1216 1316 1.44e-37 SMART
SPEC 1322 1422 4.43e-29 SMART
SPEC 1428 1528 7.54e-32 SMART
SPEC 1534 1640 2.06e-24 SMART
SPEC 1646 1746 2.32e-32 SMART
SPEC 1752 1852 6.98e-36 SMART
SPEC 1858 1958 1.53e-32 SMART
SPEC 1964 2065 6.23e-24 SMART
SPEC 2079 2179 2.08e-11 SMART
SPEC 2193 2315 3.27e0 SMART
EFh 2333 2361 5.78e-7 SMART
EFh 2376 2404 3.85e-3 SMART
efhand_Ca_insen 2408 2477 6.74e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129241
SMART Domains Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738

DomainStartEndE-ValueType
Pfam:Spectrin 1 65 9.9e-10 PFAM
SPEC 78 178 2.08e-11 SMART
SPEC 192 314 3.27e0 SMART
EFh 332 360 5.78e-7 SMART
EFh 375 403 3.85e-3 SMART
efhand_Ca_insen 407 476 6.74e-32 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Defects in this gene are a cause of short-rib thoracic dysplasia 11 with or without polydactyly. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,660,309 W1233* probably null Het
4930590J08Rik A G 6: 91,917,710 I247V probably benign Het
8030423J24Rik T A 13: 70,883,958 C50S unknown Het
Adam29 T G 8: 55,871,550 H623P probably benign Het
Adamts5 A G 16: 85,899,315 V318A probably damaging Het
Ano3 T C 2: 110,783,713 D215G possibly damaging Het
Ap3b2 A G 7: 81,463,782 I893T unknown Het
Apob G A 12: 8,008,801 A2428T probably benign Het
Armc3 T C 2: 19,296,863 V660A probably benign Het
Atf7 G T 15: 102,563,334 T42K probably damaging Het
Atg9a A T 1: 75,187,722 I160N probably damaging Het
Atp2b1 T C 10: 98,996,924 V429A possibly damaging Het
Bpifb3 A C 2: 153,922,689 H167P probably benign Het
Cacna1f G T X: 7,621,087 E921D probably damaging Het
Ccdc57 T A 11: 120,878,887 L713F probably damaging Het
Chd1l C T 3: 97,587,210 E385K possibly damaging Het
Csmd1 C T 8: 15,917,306 V3186I probably benign Het
Dclre1c T A 2: 3,447,148 D349E probably benign Het
Dlg1 C T 16: 31,842,802 T657M possibly damaging Het
Dync2h1 T C 9: 7,148,688 I919V probably benign Het
Eml5 A G 12: 98,792,514 probably null Het
Epas1 C A 17: 86,818,432 S286* probably null Het
Fat1 G A 8: 45,026,058 V2714I possibly damaging Het
Fuca2 T C 10: 13,514,801 M447T probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm11110 A C 17: 57,103,427 C24G probably null Het
Gm6176 T A 7: 22,051,168 I113F probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpat2 G T 2: 127,433,857 L518F probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Hgsnat C T 8: 25,968,412 V195I probably benign Het
Hivep3 T A 4: 120,098,386 S1300T probably damaging Het
Hs3st2 A T 7: 121,393,139 H137L probably damaging Het
Iffo1 T C 6: 125,145,818 S188P possibly damaging Het
Itih1 T C 14: 30,932,268 D684G probably damaging Het
Lrba C A 3: 86,327,705 N852K probably damaging Het
Lrriq4 T C 3: 30,655,781 S425P possibly damaging Het
Mdn1 T A 4: 32,674,003 S562T possibly damaging Het
Mex3a T C 3: 88,536,757 V380A probably benign Het
Mgat4d A T 8: 83,368,147 N271I probably damaging Het
Mmp24 T A 2: 155,807,425 V254E possibly damaging Het
Muc16 T A 9: 18,592,629 R6455S possibly damaging Het
Npffr1 T A 10: 61,623,349 V127E probably damaging Het
Obox5 T A 7: 15,758,616 N165K probably damaging Het
Olfr1513 G A 14: 52,349,887 T53M possibly damaging Het
Otulin A C 15: 27,606,295 V344G probably damaging Het
Pappa A G 4: 65,261,992 D1030G probably damaging Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Ppp2r3c C A 12: 55,297,849 M111I probably benign Het
Prss37 T C 6: 40,517,813 T13A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgo2b T A 8: 63,943,104 K39N probably damaging Het
Sike1 T C 3: 103,001,807 *208Q probably null Het
Spire1 A G 18: 67,519,321 S229P probably damaging Het
Tmem132b A G 5: 125,622,793 I132V probably benign Het
Umodl1 T C 17: 30,971,818 V213A probably damaging Het
Washc1 C G 17: 66,116,038 Q116E probably benign Het
Zfp553 T A 7: 127,236,921 C549* probably null Het
Zfp9 G A 6: 118,464,600 P367L probably damaging Het
Other mutations in Wdr34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02007:Wdr34 APN 2 30038390 missense probably benign 0.11
IGL02165:Wdr34 APN 2 30032160 missense probably benign
IGL02600:Wdr34 APN 2 30033302 missense possibly damaging 0.65
PIT1430001:Wdr34 UTSW 2 30032135 missense probably damaging 1.00
R0542:Wdr34 UTSW 2 30031825 missense probably damaging 0.98
R4065:Wdr34 UTSW 2 30032808 missense probably benign 0.03
R4067:Wdr34 UTSW 2 30032808 missense probably benign 0.03
R4750:Wdr34 UTSW 2 30033920 missense probably benign 0.00
R4907:Wdr34 UTSW 2 30032460 splice site probably null
R5008:Wdr34 UTSW 2 30032769 missense probably benign 0.14
R5253:Wdr34 UTSW 2 30032363 unclassified probably benign
R6014:Wdr34 UTSW 2 30031751 missense probably benign 0.01
R6456:Wdr34 UTSW 2 30032767 missense probably benign 0.01
R6789:Wdr34 UTSW 2 30033272 critical splice donor site probably null
R7024:Wdr34 UTSW 2 30038266 missense possibly damaging 0.61
R7319:Wdr34 UTSW 2 30038329 missense probably benign 0.00
R7576:Wdr34 UTSW 2 30048778 missense probably benign 0.00
R7640:Wdr34 UTSW 2 30031768 missense probably benign 0.00
R8025:Wdr34 UTSW 2 30048718 missense probably benign 0.00
R8273:Wdr34 UTSW 2 30031891 missense probably damaging 1.00
R8277:Wdr34 UTSW 2 30033874 missense probably benign
R8309:Wdr34 UTSW 2 30032189 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGCCATCCTGAAGCATG -3'
(R):5'- TGAAGATGGTGGCTCTCTGC -3'

Sequencing Primer
(F):5'- GGGCATCAGATCTCATTACGG -3'
(R):5'- CTGTGGTTTCTATGTGTTCTGAAC -3'
Posted On2020-06-30