Mutagenetix > Incidental Mutation

Incidental Mutation 'R8111:Ano3'

630850

Institutional Source

Beutler Lab

Gene Symbol

Ano3

Ensembl Gene

ENSMUSG00000074968

Gene Name

anoctamin 3

Synonyms

Tmem16c, B230324K02Rik

MMRRC Submission

067540-MU

Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R8111 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

110655201-110950923 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 110783713 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 215 (D215G)

Ref Sequence

ENSEMBL: ENSMUSP00000097219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099623]

AlphaFold

A2AHL1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099623
AA Change: D215G

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: D215G

Domain	Start	End	E-Value	Type
Pfam:Anoct_dimer	156	381	2.9e-70	PFAM
Pfam:Anoctamin	384	950	4.4e-138	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 93.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	C	T	14: 32,660,309	W1233*	probably null	Het
4930590J08Rik	A	G	6: 91,917,710	I247V	probably benign	Het
8030423J24Rik	T	A	13: 70,883,958	C50S	unknown	Het
Adam29	T	G	8: 55,871,550	H623P	probably benign	Het
Adamts5	A	G	16: 85,899,315	V318A	probably damaging	Het
Ap3b2	A	G	7: 81,463,782	I893T	unknown	Het
Apob	G	A	12: 8,008,801	A2428T	probably benign	Het
Armc3	T	C	2: 19,296,863	V660A	probably benign	Het
Atf7	G	T	15: 102,563,334	T42K	probably damaging	Het
Atg9a	A	T	1: 75,187,722	I160N	probably damaging	Het
Atp2b1	T	C	10: 98,996,924	V429A	possibly damaging	Het
Bpifb3	A	C	2: 153,922,689	H167P	probably benign	Het
Cacna1f	G	T	X: 7,621,087	E921D	probably damaging	Het
Ccdc57	T	A	11: 120,878,887	L713F	probably damaging	Het
Chd1l	C	T	3: 97,587,210	E385K	possibly damaging	Het
Csmd1	C	T	8: 15,917,306	V3186I	probably benign	Het
Dclre1c	T	A	2: 3,447,148	D349E	probably benign	Het
Dlg1	C	T	16: 31,842,802	T657M	possibly damaging	Het
Dync2h1	T	C	9: 7,148,688	I919V	probably benign	Het
Eml5	A	G	12: 98,792,514		probably null	Het
Epas1	C	A	17: 86,818,432	S286*	probably null	Het
Fat1	G	A	8: 45,026,058	V2714I	possibly damaging	Het
Fuca2	T	C	10: 13,514,801	M447T	probably benign	Het
Gm10800	CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA	CAAGAAAACTGAAAATCA	2: 98,667,016		probably null	Het
Gm11110	A	C	17: 57,103,427	C24G	probably null	Het
Gm6176	T	A	7: 22,051,168	I113F	probably benign	Het
Gmcl1	G	T	6: 86,721,426	A163E	probably damaging	Het
Gpat2	G	T	2: 127,433,857	L518F	probably damaging	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Hgsnat	C	T	8: 25,968,412	V195I	probably benign	Het
Hivep3	T	A	4: 120,098,386	S1300T	probably damaging	Het
Hs3st2	A	T	7: 121,393,139	H137L	probably damaging	Het
Iffo1	T	C	6: 125,145,818	S188P	possibly damaging	Het
Itih1	T	C	14: 30,932,268	D684G	probably damaging	Het
Lrba	C	A	3: 86,327,705	N852K	probably damaging	Het
Lrriq4	T	C	3: 30,655,781	S425P	possibly damaging	Het
Mdn1	T	A	4: 32,674,003	S562T	possibly damaging	Het
Mex3a	T	C	3: 88,536,757	V380A	probably benign	Het
Mgat4d	A	T	8: 83,368,147	N271I	probably damaging	Het
Mmp24	T	A	2: 155,807,425	V254E	possibly damaging	Het
Muc16	T	A	9: 18,592,629	R6455S	possibly damaging	Het
Npffr1	T	A	10: 61,623,349	V127E	probably damaging	Het
Obox5	T	A	7: 15,758,616	N165K	probably damaging	Het
Olfr1513	G	A	14: 52,349,887	T53M	possibly damaging	Het
Otulin	A	C	15: 27,606,295	V344G	probably damaging	Het
Pappa	A	G	4: 65,261,992	D1030G	probably damaging	Het
Pdzd2	G	A	15: 12,373,506	S2181L	probably benign	Het
Ppp2r3c	C	A	12: 55,297,849	M111I	probably benign	Het
Prss37	T	C	6: 40,517,813	T13A	probably benign	Het
Sfi1	TCGC	TC	11: 3,146,254		probably null	Het
Sgo2b	T	A	8: 63,943,104	K39N	probably damaging	Het
Sike1	T	C	3: 103,001,807	*208Q	probably null	Het
Spire1	A	G	18: 67,519,321	S229P	probably damaging	Het
Tmem132b	A	G	5: 125,622,793	I132V	probably benign	Het
Umodl1	T	C	17: 30,971,818	V213A	probably damaging	Het
Washc1	C	G	17: 66,116,038	Q116E	probably benign	Het
Wdr34	C	A	2: 30,031,847	A501S	possibly damaging	Het
Zfp553	T	A	7: 127,236,921	C549*	probably null	Het
Zfp9	G	A	6: 118,464,600	P367L	probably damaging	Het

Other mutations in Ano3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Ano3	APN	2	110771050	splice site	probably benign
IGL01066:Ano3	APN	2	110661445	missense	probably null	0.00
IGL01696:Ano3	APN	2	110667737	missense	probably damaging	1.00
IGL01729:Ano3	APN	2	110781394	splice site	probably null
IGL01785:Ano3	APN	2	110682715	missense	probably damaging	1.00
IGL01786:Ano3	APN	2	110682715	missense	probably damaging	1.00
IGL01992:Ano3	APN	2	110658219	missense	probably damaging	1.00
IGL02098:Ano3	APN	2	110666441	nonsense	probably null
IGL02333:Ano3	APN	2	110697199	splice site	probably benign
IGL02346:Ano3	APN	2	110770926	splice site	probably benign
IGL02352:Ano3	APN	2	110884943	nonsense	probably null
IGL02359:Ano3	APN	2	110884943	nonsense	probably null
IGL02544:Ano3	APN	2	110658249	missense	possibly damaging	0.79
IGL02750:Ano3	APN	2	110665984	splice site	probably benign
IGL02861:Ano3	APN	2	110738812	missense	probably damaging	1.00
IGL02948:Ano3	APN	2	110697018	splice site	probably benign
IGL03327:Ano3	APN	2	110697178	missense	possibly damaging	0.62
3-1:Ano3	UTSW	2	110697124	missense	probably damaging	1.00
IGL02988:Ano3	UTSW	2	110775010	missense	probably damaging	1.00
IGL03147:Ano3	UTSW	2	110697418	missense	probably damaging	1.00
R0349:Ano3	UTSW	2	110661487	missense	probably damaging	1.00
R0426:Ano3	UTSW	2	110661174	missense	probably damaging	1.00
R0523:Ano3	UTSW	2	110884855	missense	probably benign	0.13
R0557:Ano3	UTSW	2	110862952	splice site	probably null
R0611:Ano3	UTSW	2	110885001	missense	possibly damaging	0.93
R0891:Ano3	UTSW	2	110697976	missense	probably benign	0.03
R1459:Ano3	UTSW	2	110880829	missense	probably benign	0.00
R1460:Ano3	UTSW	2	110682758	missense	probably damaging	0.97
R1773:Ano3	UTSW	2	110761455	missense	probably damaging	1.00
R1874:Ano3	UTSW	2	110884872	missense	probably benign	0.00
R1919:Ano3	UTSW	2	110885007	missense	probably benign
R2185:Ano3	UTSW	2	110775045	missense	probably benign	0.01
R2280:Ano3	UTSW	2	110682759	missense	probably benign	0.22
R2281:Ano3	UTSW	2	110682759	missense	probably benign	0.22
R2348:Ano3	UTSW	2	110783743	missense	possibly damaging	0.82
R2425:Ano3	UTSW	2	110862843	missense	probably benign
R2697:Ano3	UTSW	2	110794960	missense	possibly damaging	0.79
R3888:Ano3	UTSW	2	110885000	missense	probably damaging	0.99
R3923:Ano3	UTSW	2	110770959	missense	probably damaging	1.00
R4352:Ano3	UTSW	2	110745894	missense	possibly damaging	0.74
R4447:Ano3	UTSW	2	110761578	splice site	probably null
R4790:Ano3	UTSW	2	110884919	missense	probably benign
R4832:Ano3	UTSW	2	110667722	missense	probably damaging	1.00
R4916:Ano3	UTSW	2	110771020	missense	possibly damaging	0.74
R5113:Ano3	UTSW	2	110661480	missense	possibly damaging	0.61
R5486:Ano3	UTSW	2	110745870	missense	probably damaging	1.00
R5498:Ano3	UTSW	2	110697103	missense	possibly damaging	0.68
R5589:Ano3	UTSW	2	110884995	missense	probably damaging	0.99
R5627:Ano3	UTSW	2	110756953	missense	possibly damaging	0.61
R5741:Ano3	UTSW	2	110658273	missense	probably benign	0.11
R5767:Ano3	UTSW	2	110661271	missense	probably damaging	1.00
R5883:Ano3	UTSW	2	110880864	missense	probably null	0.15
R5899:Ano3	UTSW	2	110862887	missense	probably benign	0.39
R5916:Ano3	UTSW	2	110681836	missense	probably benign	0.29
R6158:Ano3	UTSW	2	110665875	missense	probably damaging	1.00
R6315:Ano3	UTSW	2	110697039	missense	probably damaging	1.00
R6401:Ano3	UTSW	2	110775114	missense	probably benign	0.01
R6481:Ano3	UTSW	2	110795027	missense	probably benign	0.16
R6482:Ano3	UTSW	2	110697055	missense	probably damaging	1.00
R6587:Ano3	UTSW	2	110797904	splice site	probably null
R6811:Ano3	UTSW	2	110880867	missense	probably benign	0.03
R7048:Ano3	UTSW	2	110682771	nonsense	probably null
R7145:Ano3	UTSW	2	110862860	missense	probably benign	0.31
R7207:Ano3	UTSW	2	110781423	missense	probably damaging	0.96
R7215:Ano3	UTSW	2	110665932	missense	probably damaging	1.00
R7366:Ano3	UTSW	2	110757067	missense	probably damaging	1.00
R7371:Ano3	UTSW	2	110884849	critical splice donor site	probably null
R7568:Ano3	UTSW	2	110950293	start gained	probably benign
R7636:Ano3	UTSW	2	110682703	nonsense	probably null
R7888:Ano3	UTSW	2	110666428	missense	probably damaging	1.00
R7992:Ano3	UTSW	2	110775022	missense	possibly damaging	0.77
R8024:Ano3	UTSW	2	110667783	missense	probably damaging	0.99
R8074:Ano3	UTSW	2	110950232	start gained	probably benign
R8177:Ano3	UTSW	2	110666456	missense	probably damaging	1.00
R8297:Ano3	UTSW	2	110661271	missense	probably damaging	1.00
R8485:Ano3	UTSW	2	110667855	critical splice acceptor site	probably null
R8509:Ano3	UTSW	2	110665835	missense	possibly damaging	0.50
R8870:Ano3	UTSW	2	110783729	missense	probably benign	0.12
R9071:Ano3	UTSW	2	110795073	critical splice acceptor site	probably null
R9072:Ano3	UTSW	2	110745898	missense	probably benign	0.06
R9073:Ano3	UTSW	2	110745898	missense	probably benign	0.06
R9315:Ano3	UTSW	2	110697942	missense	probably damaging	0.97
R9376:Ano3	UTSW	2	110666437	missense	probably damaging	1.00
R9588:Ano3	UTSW	2	110697997	missense	possibly damaging	0.91
R9697:Ano3	UTSW	2	110665908	missense	probably damaging	1.00
R9716:Ano3	UTSW	2	110771031	missense	probably damaging	0.97
R9748:Ano3	UTSW	2	110658295	missense	probably damaging	1.00
RF012:Ano3	UTSW	2	110697523	missense	possibly damaging	0.83
RF013:Ano3	UTSW	2	110697036	missense	probably benign	0.30
X0058:Ano3	UTSW	2	110697418	missense	probably damaging	1.00
Z1088:Ano3	UTSW	2	110745847	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGGGACTCAGAAAGCTTAC -3'
(R):5'- TCAATGGACTCTGATGAGGTG -3'

Sequencing Primer
(F):5'- CATTATTCAAACAATCCGGGGG -3'
(R):5'- ACTCTGATGAGGTGTTTCTCTGAAAC -3'

Posted On

2020-06-30