Incidental Mutation 'R8111:Ano3'
ID630850
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Nameanoctamin 3
SynonymsTmem16c, B230324K02Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R8111 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location110655201-110950923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110783713 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 215 (D215G)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099623
AA Change: D215G

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: D215G

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,660,309 W1233* probably null Het
4930590J08Rik A G 6: 91,917,710 I247V probably benign Het
8030423J24Rik T A 13: 70,883,958 C50S unknown Het
Adam29 T G 8: 55,871,550 H623P probably benign Het
Adamts5 A G 16: 85,899,315 V318A probably damaging Het
Ap3b2 A G 7: 81,463,782 I893T unknown Het
Apob G A 12: 8,008,801 A2428T probably benign Het
Armc3 T C 2: 19,296,863 V660A probably benign Het
Atf7 G T 15: 102,563,334 T42K probably damaging Het
Atg9a A T 1: 75,187,722 I160N probably damaging Het
Atp2b1 T C 10: 98,996,924 V429A possibly damaging Het
Bpifb3 A C 2: 153,922,689 H167P probably benign Het
Cacna1f G T X: 7,621,087 E921D probably damaging Het
Ccdc57 T A 11: 120,878,887 L713F probably damaging Het
Chd1l C T 3: 97,587,210 E385K possibly damaging Het
Csmd1 C T 8: 15,917,306 V3186I probably benign Het
Dclre1c T A 2: 3,447,148 D349E probably benign Het
Dlg1 C T 16: 31,842,802 T657M possibly damaging Het
Dync2h1 T C 9: 7,148,688 I919V probably benign Het
Eml5 A G 12: 98,792,514 probably null Het
Epas1 C A 17: 86,818,432 S286* probably null Het
Fat1 G A 8: 45,026,058 V2714I possibly damaging Het
Fuca2 T C 10: 13,514,801 M447T probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm11110 A C 17: 57,103,427 C24G probably null Het
Gm6176 T A 7: 22,051,168 I113F probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpat2 G T 2: 127,433,857 L518F probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Hgsnat C T 8: 25,968,412 V195I probably benign Het
Hivep3 T A 4: 120,098,386 S1300T probably damaging Het
Hs3st2 A T 7: 121,393,139 H137L probably damaging Het
Iffo1 T C 6: 125,145,818 S188P possibly damaging Het
Itih1 T C 14: 30,932,268 D684G probably damaging Het
Lrba C A 3: 86,327,705 N852K probably damaging Het
Lrriq4 T C 3: 30,655,781 S425P possibly damaging Het
Mdn1 T A 4: 32,674,003 S562T possibly damaging Het
Mex3a T C 3: 88,536,757 V380A probably benign Het
Mgat4d A T 8: 83,368,147 N271I probably damaging Het
Mmp24 T A 2: 155,807,425 V254E possibly damaging Het
Muc16 T A 9: 18,592,629 R6455S possibly damaging Het
Npffr1 T A 10: 61,623,349 V127E probably damaging Het
Obox5 T A 7: 15,758,616 N165K probably damaging Het
Olfr1513 G A 14: 52,349,887 T53M possibly damaging Het
Otulin A C 15: 27,606,295 V344G probably damaging Het
Pappa A G 4: 65,261,992 D1030G probably damaging Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Ppp2r3c C A 12: 55,297,849 M111I probably benign Het
Prss37 T C 6: 40,517,813 T13A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgo2b T A 8: 63,943,104 K39N probably damaging Het
Sike1 T C 3: 103,001,807 *208Q probably null Het
Spire1 A G 18: 67,519,321 S229P probably damaging Het
Tmem132b A G 5: 125,622,793 I132V probably benign Het
Umodl1 T C 17: 30,971,818 V213A probably damaging Het
Washc1 C G 17: 66,116,038 Q116E probably benign Het
Wdr34 C A 2: 30,031,847 A501S possibly damaging Het
Zfp553 T A 7: 127,236,921 C549* probably null Het
Zfp9 G A 6: 118,464,600 P367L probably damaging Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110697418 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0557:Ano3 UTSW 2 110862952 splice site probably null
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1459:Ano3 UTSW 2 110880829 missense probably benign 0.00
R1460:Ano3 UTSW 2 110682758 missense probably damaging 0.97
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R1919:Ano3 UTSW 2 110885007 missense probably benign
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110885000 missense probably damaging 0.99
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 splice site probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R4916:Ano3 UTSW 2 110771020 missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110745870 missense probably damaging 1.00
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110884995 missense probably damaging 0.99
R5627:Ano3 UTSW 2 110756953 missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6158:Ano3 UTSW 2 110665875 missense probably damaging 1.00
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6401:Ano3 UTSW 2 110775114 missense probably benign 0.01
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 splice site probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
R7568:Ano3 UTSW 2 110950293 start gained probably benign
R7636:Ano3 UTSW 2 110682703 nonsense probably null
R7888:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R7992:Ano3 UTSW 2 110775022 missense possibly damaging 0.77
R8024:Ano3 UTSW 2 110667783 missense probably damaging 0.99
R8074:Ano3 UTSW 2 110950232 start gained probably benign
R8177:Ano3 UTSW 2 110666456 missense probably damaging 1.00
R8297:Ano3 UTSW 2 110661271 missense probably damaging 1.00
RF012:Ano3 UTSW 2 110697523 missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110697036 missense probably benign 0.30
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGGACTCAGAAAGCTTAC -3'
(R):5'- TCAATGGACTCTGATGAGGTG -3'

Sequencing Primer
(F):5'- CATTATTCAAACAATCCGGGGG -3'
(R):5'- ACTCTGATGAGGTGTTTCTCTGAAAC -3'
Posted On2020-06-30