Incidental Mutation 'R8111:Hgsnat'
ID630874
Institutional Source Beutler Lab
Gene Symbol Hgsnat
Ensembl Gene ENSMUSG00000037260
Gene Nameheparan-alpha-glucosaminide N-acetyltransferase
SynonymsD8Ertd354e, 9430010M12Rik, Tmem76
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_029884.1; MGI:1196297

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8111 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location25944453-25976753 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25968412 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 195 (V195I)
Ref Sequence ENSEMBL: ENSMUSP00000040356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037609] [ENSMUST00000211550]
Predicted Effect probably benign
Transcript: ENSMUST00000037609
AA Change: V195I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000040356
Gene: ENSMUSG00000037260
AA Change: V195I

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
Pfam:DUF1624 260 434 6.8e-11 PFAM
Pfam:DUF5009 286 389 2.4e-10 PFAM
transmembrane domain 494 516 N/A INTRINSIC
transmembrane domain 523 545 N/A INTRINSIC
transmembrane domain 560 582 N/A INTRINSIC
transmembrane domain 587 609 N/A INTRINSIC
transmembrane domain 629 648 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211550
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal acetyltransferase, which is one of several enzymes involved in the lysosomal degradation of heparin sulfate. Mutations in this gene are associated with Sanfilippo syndrome C, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit progressive storage pathology in the CNS and peripheral organs, glycosaminoglycan accumulation in brain and most somatic organs, lysosomal distension and dysfunction, astrocytosis, microgliosis, hepatosplenomegaly, behavioral deficits and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(3) Gene trapped(6)

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,660,309 W1233* probably null Het
4930590J08Rik A G 6: 91,917,710 I247V probably benign Het
8030423J24Rik T A 13: 70,883,958 C50S unknown Het
Adam29 T G 8: 55,871,550 H623P probably benign Het
Adamts5 A G 16: 85,899,315 V318A probably damaging Het
Ano3 T C 2: 110,783,713 D215G possibly damaging Het
Ap3b2 A G 7: 81,463,782 I893T unknown Het
Apob G A 12: 8,008,801 A2428T probably benign Het
Armc3 T C 2: 19,296,863 V660A probably benign Het
Atf7 G T 15: 102,563,334 T42K probably damaging Het
Atg9a A T 1: 75,187,722 I160N probably damaging Het
Atp2b1 T C 10: 98,996,924 V429A possibly damaging Het
Bpifb3 A C 2: 153,922,689 H167P probably benign Het
Cacna1f G T X: 7,621,087 E921D probably damaging Het
Ccdc57 T A 11: 120,878,887 L713F probably damaging Het
Chd1l C T 3: 97,587,210 E385K possibly damaging Het
Csmd1 C T 8: 15,917,306 V3186I probably benign Het
Dclre1c T A 2: 3,447,148 D349E probably benign Het
Dlg1 C T 16: 31,842,802 T657M possibly damaging Het
Dync2h1 T C 9: 7,148,688 I919V probably benign Het
Eml5 A G 12: 98,792,514 probably null Het
Epas1 C A 17: 86,818,432 S286* probably null Het
Fat1 G A 8: 45,026,058 V2714I possibly damaging Het
Fuca2 T C 10: 13,514,801 M447T probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm11110 A C 17: 57,103,427 C24G probably null Het
Gm6176 T A 7: 22,051,168 I113F probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpat2 G T 2: 127,433,857 L518F probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Hivep3 T A 4: 120,098,386 S1300T probably damaging Het
Hs3st2 A T 7: 121,393,139 H137L probably damaging Het
Iffo1 T C 6: 125,145,818 S188P possibly damaging Het
Itih1 T C 14: 30,932,268 D684G probably damaging Het
Lrba C A 3: 86,327,705 N852K probably damaging Het
Lrriq4 T C 3: 30,655,781 S425P possibly damaging Het
Mdn1 T A 4: 32,674,003 S562T possibly damaging Het
Mex3a T C 3: 88,536,757 V380A probably benign Het
Mgat4d A T 8: 83,368,147 N271I probably damaging Het
Mmp24 T A 2: 155,807,425 V254E possibly damaging Het
Muc16 T A 9: 18,592,629 R6455S possibly damaging Het
Npffr1 T A 10: 61,623,349 V127E probably damaging Het
Obox5 T A 7: 15,758,616 N165K probably damaging Het
Olfr1513 G A 14: 52,349,887 T53M possibly damaging Het
Otulin A C 15: 27,606,295 V344G probably damaging Het
Pappa A G 4: 65,261,992 D1030G probably damaging Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Ppp2r3c C A 12: 55,297,849 M111I probably benign Het
Prss37 T C 6: 40,517,813 T13A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgo2b T A 8: 63,943,104 K39N probably damaging Het
Sike1 T C 3: 103,001,807 *208Q probably null Het
Spire1 A G 18: 67,519,321 S229P probably damaging Het
Tmem132b A G 5: 125,622,793 I132V probably benign Het
Umodl1 T C 17: 30,971,818 V213A probably damaging Het
Washc1 C G 17: 66,116,038 Q116E probably benign Het
Wdr34 C A 2: 30,031,847 A501S possibly damaging Het
Zfp553 T A 7: 127,236,921 C549* probably null Het
Zfp9 G A 6: 118,464,600 P367L probably damaging Het
Other mutations in Hgsnat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Hgsnat APN 8 25972937 missense probably benign 0.04
IGL02950:Hgsnat APN 8 25971701 missense probably damaging 1.00
IGL03145:Hgsnat APN 8 25946452 missense probably damaging 1.00
ample UTSW 8 25947960 nonsense probably null
generous UTSW 8 25968361 critical splice donor site probably null
P0018:Hgsnat UTSW 8 25968354 unclassified probably benign
PIT4305001:Hgsnat UTSW 8 25945199 missense possibly damaging 0.67
R1396:Hgsnat UTSW 8 25957335 missense possibly damaging 0.95
R1676:Hgsnat UTSW 8 25954605 critical splice donor site probably null
R1856:Hgsnat UTSW 8 25957256 missense probably benign 0.06
R1998:Hgsnat UTSW 8 25945252 nonsense probably null
R2497:Hgsnat UTSW 8 25945252 nonsense probably null
R2570:Hgsnat UTSW 8 25945252 nonsense probably null
R4012:Hgsnat UTSW 8 25955789 nonsense probably null
R4080:Hgsnat UTSW 8 25946343 missense probably benign 0.02
R4462:Hgsnat UTSW 8 25954636 missense probably damaging 1.00
R4523:Hgsnat UTSW 8 25968361 critical splice donor site probably null
R4914:Hgsnat UTSW 8 25964838 missense probably damaging 0.98
R5010:Hgsnat UTSW 8 25947960 nonsense probably null
R5561:Hgsnat UTSW 8 25946334 missense possibly damaging 0.90
R5889:Hgsnat UTSW 8 25963367 missense probably damaging 1.00
R6411:Hgsnat UTSW 8 25946275 missense possibly damaging 0.88
R6520:Hgsnat UTSW 8 25953300 missense probably damaging 1.00
R6524:Hgsnat UTSW 8 25945232 missense probably damaging 1.00
R7230:Hgsnat UTSW 8 25954832 splice site probably null
R7462:Hgsnat UTSW 8 25957213 missense probably benign 0.45
R7509:Hgsnat UTSW 8 25955726 missense probably damaging 0.98
R7526:Hgsnat UTSW 8 25971049 missense probably damaging 1.00
R7583:Hgsnat UTSW 8 25971564 critical splice donor site probably null
R7679:Hgsnat UTSW 8 25954637 missense probably damaging 1.00
R8206:Hgsnat UTSW 8 25954637 missense probably damaging 1.00
R8321:Hgsnat UTSW 8 25971151 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GGAATAGAACCGTCATGGCG -3'
(R):5'- TGAGTATATCATGTAGCTCTCCTGC -3'

Sequencing Primer
(F):5'- GTCATGGCGGATGTACAAATCCTAC -3'
(R):5'- GCTTCCTCACACAGAGTTTAACATGG -3'
Posted On2020-06-30