Incidental Mutation 'R8111:Atp2b1'
ID630883
Institutional Source Beutler Lab
Gene Symbol Atp2b1
Ensembl Gene ENSMUSG00000019943
Gene NameATPase, Ca++ transporting, plasma membrane 1
SynonymsPMCA1, 2810442I22Rik, E130111D10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8111 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location98914406-99026143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98996924 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 429 (V429A)
Ref Sequence ENSEMBL: ENSMUSP00000020107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020107] [ENSMUST00000219624]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020107
AA Change: V429A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020107
Gene: ENSMUSG00000019943
AA Change: V429A

DomainStartEndE-ValueType
Cation_ATPase_N 50 126 1.8e-3 SMART
low complexity region 138 156 N/A INTRINSIC
Pfam:E1-E2_ATPase 157 312 1.5e-28 PFAM
Pfam:E1-E2_ATPase 348 464 1.4e-13 PFAM
Pfam:HAD 472 806 6.9e-22 PFAM
Pfam:Cation_ATPase 492 614 8.8e-17 PFAM
Pfam:Hydrolase 605 809 5.8e-14 PFAM
Pfam:Hydrolase_3 764 842 7.2e-7 PFAM
transmembrane domain 855 877 N/A INTRINSIC
Pfam:Cation_ATPase_C 879 1061 1.2e-47 PFAM
low complexity region 1079 1092 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1103 1155 7.5e-31 PFAM
low complexity region 1176 1188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219090
Predicted Effect possibly damaging
Transcript: ENSMUST00000219624
AA Change: V429A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 1. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,660,309 W1233* probably null Het
4930590J08Rik A G 6: 91,917,710 I247V probably benign Het
8030423J24Rik T A 13: 70,883,958 C50S unknown Het
Adam29 T G 8: 55,871,550 H623P probably benign Het
Adamts5 A G 16: 85,899,315 V318A probably damaging Het
Ano3 T C 2: 110,783,713 D215G possibly damaging Het
Ap3b2 A G 7: 81,463,782 I893T unknown Het
Apob G A 12: 8,008,801 A2428T probably benign Het
Armc3 T C 2: 19,296,863 V660A probably benign Het
Atf7 G T 15: 102,563,334 T42K probably damaging Het
Atg9a A T 1: 75,187,722 I160N probably damaging Het
Bpifb3 A C 2: 153,922,689 H167P probably benign Het
Cacna1f G T X: 7,621,087 E921D probably damaging Het
Ccdc57 T A 11: 120,878,887 L713F probably damaging Het
Chd1l C T 3: 97,587,210 E385K possibly damaging Het
Csmd1 C T 8: 15,917,306 V3186I probably benign Het
Dclre1c T A 2: 3,447,148 D349E probably benign Het
Dlg1 C T 16: 31,842,802 T657M possibly damaging Het
Dync2h1 T C 9: 7,148,688 I919V probably benign Het
Eml5 A G 12: 98,792,514 probably null Het
Epas1 C A 17: 86,818,432 S286* probably null Het
Fat1 G A 8: 45,026,058 V2714I possibly damaging Het
Fuca2 T C 10: 13,514,801 M447T probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm11110 A C 17: 57,103,427 C24G probably null Het
Gm6176 T A 7: 22,051,168 I113F probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpat2 G T 2: 127,433,857 L518F probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Hgsnat C T 8: 25,968,412 V195I probably benign Het
Hivep3 T A 4: 120,098,386 S1300T probably damaging Het
Hs3st2 A T 7: 121,393,139 H137L probably damaging Het
Iffo1 T C 6: 125,145,818 S188P possibly damaging Het
Itih1 T C 14: 30,932,268 D684G probably damaging Het
Lrba C A 3: 86,327,705 N852K probably damaging Het
Lrriq4 T C 3: 30,655,781 S425P possibly damaging Het
Mdn1 T A 4: 32,674,003 S562T possibly damaging Het
Mex3a T C 3: 88,536,757 V380A probably benign Het
Mgat4d A T 8: 83,368,147 N271I probably damaging Het
Mmp24 T A 2: 155,807,425 V254E possibly damaging Het
Muc16 T A 9: 18,592,629 R6455S possibly damaging Het
Npffr1 T A 10: 61,623,349 V127E probably damaging Het
Obox5 T A 7: 15,758,616 N165K probably damaging Het
Olfr1513 G A 14: 52,349,887 T53M possibly damaging Het
Otulin A C 15: 27,606,295 V344G probably damaging Het
Pappa A G 4: 65,261,992 D1030G probably damaging Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Ppp2r3c C A 12: 55,297,849 M111I probably benign Het
Prss37 T C 6: 40,517,813 T13A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgo2b T A 8: 63,943,104 K39N probably damaging Het
Sike1 T C 3: 103,001,807 *208Q probably null Het
Spire1 A G 18: 67,519,321 S229P probably damaging Het
Tmem132b A G 5: 125,622,793 I132V probably benign Het
Umodl1 T C 17: 30,971,818 V213A probably damaging Het
Washc1 C G 17: 66,116,038 Q116E probably benign Het
Wdr34 C A 2: 30,031,847 A501S possibly damaging Het
Zfp553 T A 7: 127,236,921 C549* probably null Het
Zfp9 G A 6: 118,464,600 P367L probably damaging Het
Other mutations in Atp2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Atp2b1 APN 10 99015020 missense possibly damaging 0.84
IGL00972:Atp2b1 APN 10 99015044 missense probably damaging 1.00
IGL00977:Atp2b1 APN 10 98986975 missense possibly damaging 0.88
IGL01154:Atp2b1 APN 10 98996888 missense probably damaging 1.00
IGL03073:Atp2b1 APN 10 98999851 missense probably damaging 1.00
IGL03081:Atp2b1 APN 10 98994813 splice site probably benign
PIT4453001:Atp2b1 UTSW 10 99016978 missense probably benign 0.00
R0157:Atp2b1 UTSW 10 98999947 missense probably damaging 0.99
R0200:Atp2b1 UTSW 10 98979814 nonsense probably null
R0899:Atp2b1 UTSW 10 99017031 critical splice donor site probably null
R0981:Atp2b1 UTSW 10 99015629 missense probably damaging 1.00
R1163:Atp2b1 UTSW 10 98979851 missense possibly damaging 0.91
R1569:Atp2b1 UTSW 10 98987326 missense probably benign 0.02
R1572:Atp2b1 UTSW 10 98994675 missense probably benign 0.10
R1574:Atp2b1 UTSW 10 98996948 missense probably damaging 1.00
R1574:Atp2b1 UTSW 10 98996948 missense probably damaging 1.00
R1721:Atp2b1 UTSW 10 98996888 missense probably damaging 1.00
R1782:Atp2b1 UTSW 10 99003201 missense probably benign 0.01
R1840:Atp2b1 UTSW 10 99022929 missense probably benign 0.00
R1867:Atp2b1 UTSW 10 98996888 missense probably damaging 1.00
R1868:Atp2b1 UTSW 10 98996888 missense probably damaging 1.00
R1944:Atp2b1 UTSW 10 99022931 missense probably damaging 0.97
R1984:Atp2b1 UTSW 10 99014492 missense possibly damaging 0.95
R2055:Atp2b1 UTSW 10 99014559 missense probably damaging 1.00
R2325:Atp2b1 UTSW 10 99018895 nonsense probably null
R2399:Atp2b1 UTSW 10 98999923 missense probably benign 0.02
R2876:Atp2b1 UTSW 10 98999745 missense probably damaging 0.96
R3762:Atp2b1 UTSW 10 99009489 missense probably damaging 1.00
R3776:Atp2b1 UTSW 10 98979869 frame shift probably null
R3808:Atp2b1 UTSW 10 99003148 missense possibly damaging 0.74
R3978:Atp2b1 UTSW 10 98996933 splice site probably null
R4391:Atp2b1 UTSW 10 99003214 missense probably benign 0.00
R4825:Atp2b1 UTSW 10 99009564 missense probably damaging 1.00
R5755:Atp2b1 UTSW 10 99003170 missense probably damaging 1.00
R5755:Atp2b1 UTSW 10 98994809 critical splice donor site probably null
R6018:Atp2b1 UTSW 10 99010760 missense probably damaging 1.00
R6179:Atp2b1 UTSW 10 99022829 missense probably damaging 1.00
R6455:Atp2b1 UTSW 10 99016980 missense possibly damaging 0.76
R6496:Atp2b1 UTSW 10 99003337 missense probably damaging 0.98
R6786:Atp2b1 UTSW 10 99016959 missense probably damaging 1.00
R6814:Atp2b1 UTSW 10 99023015 missense possibly damaging 0.87
R7034:Atp2b1 UTSW 10 98987310 missense probably damaging 1.00
R7036:Atp2b1 UTSW 10 98987310 missense probably damaging 1.00
R7079:Atp2b1 UTSW 10 99018733 missense probably benign 0.01
R7216:Atp2b1 UTSW 10 98986977 missense probably benign 0.30
R7510:Atp2b1 UTSW 10 98993896 missense probably benign 0.01
R7562:Atp2b1 UTSW 10 99022805 splice site probably null
R7651:Atp2b1 UTSW 10 99016968 missense probably damaging 0.99
R7739:Atp2b1 UTSW 10 99001365 missense probably benign 0.01
R8005:Atp2b1 UTSW 10 98994799 missense probably damaging 1.00
Z1177:Atp2b1 UTSW 10 99018848 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGGCTGCTACATTTAAACAATTGTC -3'
(R):5'- CAGAAGTCCTGGAATCACTGC -3'

Sequencing Primer
(F):5'- AAACAATTGTCCTGTTTCCTGC -3'
(R):5'- GGAATCACTGCCTGCATTTTTAAGG -3'
Posted On2020-06-30