Incidental Mutation 'R8111:Sfi1'
ID630884
Institutional Source Beutler Lab
Gene Symbol Sfi1
Ensembl Gene ENSMUSG00000023764
Gene NameSfi1 homolog, spindle assembly associated (yeast)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R8111 (G1)
Quality Score217.468
Status Not validated
Chromosome11
Chromosomal Location3131850-3193463 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCGC to TC at 3146254 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066391] [ENSMUST00000081318] [ENSMUST00000101655] [ENSMUST00000132893] [ENSMUST00000140846] [ENSMUST00000153425]
Predicted Effect probably null
Transcript: ENSMUST00000066391
SMART Domains Protein: ENSMUSP00000067261
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_2 34 236 4.95e-5 PROSPERO
internal_repeat_1 78 336 3.02e-14 PROSPERO
low complexity region 342 358 N/A INTRINSIC
internal_repeat_1 372 636 3.02e-14 PROSPERO
internal_repeat_2 574 804 4.95e-5 PROSPERO
low complexity region 809 821 N/A INTRINSIC
low complexity region 849 860 N/A INTRINSIC
coiled coil region 1086 1112 N/A INTRINSIC
coiled coil region 1138 1168 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000081318
SMART Domains Protein: ENSMUSP00000080066
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_3 55 275 2e-6 PROSPERO
internal_repeat_1 67 288 7.56e-9 PROSPERO
internal_repeat_2 93 401 1.18e-6 PROSPERO
internal_repeat_3 380 607 2e-6 PROSPERO
internal_repeat_1 428 651 7.56e-9 PROSPERO
internal_repeat_2 524 836 1.18e-6 PROSPERO
low complexity region 841 853 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
coiled coil region 1118 1144 N/A INTRINSIC
coiled coil region 1170 1200 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101655
SMART Domains Protein: ENSMUSP00000099178
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_3 55 275 1.77e-6 PROSPERO
internal_repeat_1 67 288 6.51e-9 PROSPERO
internal_repeat_2 93 401 1.04e-6 PROSPERO
internal_repeat_3 380 607 1.77e-6 PROSPERO
internal_repeat_1 428 651 6.51e-9 PROSPERO
internal_repeat_2 524 836 1.04e-6 PROSPERO
low complexity region 841 853 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
coiled coil region 1107 1133 N/A INTRINSIC
coiled coil region 1159 1189 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120853
Predicted Effect probably null
Transcript: ENSMUST00000126746
SMART Domains Protein: ENSMUSP00000122002
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
low complexity region 73 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131021
Predicted Effect probably null
Transcript: ENSMUST00000132893
SMART Domains Protein: ENSMUSP00000118419
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
low complexity region 210 223 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138126
Predicted Effect probably null
Transcript: ENSMUST00000140846
SMART Domains Protein: ENSMUSP00000119905
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_1 3 301 3.65e-15 PROSPERO
internal_repeat_2 12 320 8.53e-7 PROSPERO
internal_repeat_1 301 599 3.65e-15 PROSPERO
internal_repeat_2 443 755 8.53e-7 PROSPERO
low complexity region 760 772 N/A INTRINSIC
low complexity region 800 811 N/A INTRINSIC
coiled coil region 1026 1052 N/A INTRINSIC
coiled coil region 1078 1108 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144359
Predicted Effect probably null
Transcript: ENSMUST00000153425
SMART Domains Protein: ENSMUSP00000121719
Gene: ENSMUSG00000023764

DomainStartEndE-ValueType
internal_repeat_1 67 288 6.06e-9 PROSPERO
internal_repeat_3 69 314 2.4e-5 PROSPERO
internal_repeat_2 93 340 2.83e-6 PROSPERO
low complexity region 342 358 N/A INTRINSIC
internal_repeat_1 397 620 6.06e-9 PROSPERO
internal_repeat_2 493 744 2.83e-6 PROSPERO
internal_repeat_3 531 799 2.4e-5 PROSPERO
low complexity region 810 822 N/A INTRINSIC
low complexity region 850 861 N/A INTRINSIC
coiled coil region 1076 1102 N/A INTRINSIC
coiled coil region 1128 1158 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144778
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,660,309 W1233* probably null Het
4930590J08Rik A G 6: 91,917,710 I247V probably benign Het
8030423J24Rik T A 13: 70,883,958 C50S unknown Het
Adam29 T G 8: 55,871,550 H623P probably benign Het
Adamts5 A G 16: 85,899,315 V318A probably damaging Het
Ano3 T C 2: 110,783,713 D215G possibly damaging Het
Ap3b2 A G 7: 81,463,782 I893T unknown Het
Apob G A 12: 8,008,801 A2428T probably benign Het
Armc3 T C 2: 19,296,863 V660A probably benign Het
Atf7 G T 15: 102,563,334 T42K probably damaging Het
Atg9a A T 1: 75,187,722 I160N probably damaging Het
Atp2b1 T C 10: 98,996,924 V429A possibly damaging Het
Bpifb3 A C 2: 153,922,689 H167P probably benign Het
Cacna1f G T X: 7,621,087 E921D probably damaging Het
Ccdc57 T A 11: 120,878,887 L713F probably damaging Het
Chd1l C T 3: 97,587,210 E385K possibly damaging Het
Csmd1 C T 8: 15,917,306 V3186I probably benign Het
Dclre1c T A 2: 3,447,148 D349E probably benign Het
Dlg1 C T 16: 31,842,802 T657M possibly damaging Het
Dync2h1 T C 9: 7,148,688 I919V probably benign Het
Eml5 A G 12: 98,792,514 probably null Het
Epas1 C A 17: 86,818,432 S286* probably null Het
Fat1 G A 8: 45,026,058 V2714I possibly damaging Het
Fuca2 T C 10: 13,514,801 M447T probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm11110 A C 17: 57,103,427 C24G probably null Het
Gm6176 T A 7: 22,051,168 I113F probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpat2 G T 2: 127,433,857 L518F probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Hgsnat C T 8: 25,968,412 V195I probably benign Het
Hivep3 T A 4: 120,098,386 S1300T probably damaging Het
Hs3st2 A T 7: 121,393,139 H137L probably damaging Het
Iffo1 T C 6: 125,145,818 S188P possibly damaging Het
Itih1 T C 14: 30,932,268 D684G probably damaging Het
Lrba C A 3: 86,327,705 N852K probably damaging Het
Lrriq4 T C 3: 30,655,781 S425P possibly damaging Het
Mdn1 T A 4: 32,674,003 S562T possibly damaging Het
Mex3a T C 3: 88,536,757 V380A probably benign Het
Mgat4d A T 8: 83,368,147 N271I probably damaging Het
Mmp24 T A 2: 155,807,425 V254E possibly damaging Het
Muc16 T A 9: 18,592,629 R6455S possibly damaging Het
Npffr1 T A 10: 61,623,349 V127E probably damaging Het
Obox5 T A 7: 15,758,616 N165K probably damaging Het
Olfr1513 G A 14: 52,349,887 T53M possibly damaging Het
Otulin A C 15: 27,606,295 V344G probably damaging Het
Pappa A G 4: 65,261,992 D1030G probably damaging Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Ppp2r3c C A 12: 55,297,849 M111I probably benign Het
Prss37 T C 6: 40,517,813 T13A probably benign Het
Sgo2b T A 8: 63,943,104 K39N probably damaging Het
Sike1 T C 3: 103,001,807 *208Q probably null Het
Spire1 A G 18: 67,519,321 S229P probably damaging Het
Tmem132b A G 5: 125,622,793 I132V probably benign Het
Umodl1 T C 17: 30,971,818 V213A probably damaging Het
Washc1 C G 17: 66,116,038 Q116E probably benign Het
Wdr34 C A 2: 30,031,847 A501S possibly damaging Het
Zfp553 T A 7: 127,236,921 C549* probably null Het
Zfp9 G A 6: 118,464,600 P367L probably damaging Het
Other mutations in Sfi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Sfi1 APN 11 3134337 missense probably benign 0.05
IGL00990:Sfi1 APN 11 3135671 missense probably damaging 0.99
IGL00990:Sfi1 APN 11 3143689 splice site probably benign
IGL03147:Sfi1 UTSW 11 3186080 missense possibly damaging 0.94
R0081:Sfi1 UTSW 11 3146254 frame shift probably null
R0082:Sfi1 UTSW 11 3146254 frame shift probably null
R0118:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0197:Sfi1 UTSW 11 3146254 frame shift probably null
R0241:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0241:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0242:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R0816:Sfi1 UTSW 11 3146254 frame shift probably null
R1147:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1148:Sfi1 UTSW 11 3146254 frame shift probably null
R1148:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1185:Sfi1 UTSW 11 3146254 frame shift probably null
R1185:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1207:Sfi1 UTSW 11 3146254 frame shift probably null
R1207:Sfi1 UTSW 11 3146255 frame shift probably null
R1207:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1403:Sfi1 UTSW 11 3146254 frame shift probably null
R1403:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1404:Sfi1 UTSW 11 3146254 frame shift probably null
R1404:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1405:Sfi1 UTSW 11 3146254 frame shift probably null
R1405:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1465:Sfi1 UTSW 11 3146254 frame shift probably null
R1469:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R1470:Sfi1 UTSW 11 3146254 frame shift probably null
R1470:Sfi1 UTSW 11 3146255 frame shift probably null
R1574:Sfi1 UTSW 11 3146254 frame shift probably null
R2871:Sfi1 UTSW 11 3177419 critical splice donor site probably benign
R5228:Sfi1 UTSW 11 3153384 intron probably benign
R5276:Sfi1 UTSW 11 3153384 intron probably benign
R5298:Sfi1 UTSW 11 3153384 intron probably benign
R5343:Sfi1 UTSW 11 3153384 intron probably benign
R5376:Sfi1 UTSW 11 3153384 intron probably benign
R5384:Sfi1 UTSW 11 3153382 intron probably benign
R5385:Sfi1 UTSW 11 3153382 intron probably benign
R5386:Sfi1 UTSW 11 3153384 intron probably benign
R5411:Sfi1 UTSW 11 3153384 intron probably benign
R5431:Sfi1 UTSW 11 3153384 intron probably benign
R5795:Sfi1 UTSW 11 3153384 intron probably benign
R5808:Sfi1 UTSW 11 3153384 intron probably benign
R7536:Sfi1 UTSW 11 3153382 intron probably benign
R7642:Sfi1 UTSW 11 3153382 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTCTGAAAACCCAGAGGACCAG -3'
(R):5'- ACACTGCATACGATTAAAGATGC -3'

Sequencing Primer
(F):5'- GGAAACCAGTAACACAAAGCCAAGG -3'
(R):5'- TATAGCTGTGAGCCACCATG -3'
Posted On2020-06-30