Mutagenetix > Incidental Mutations

Incidental Mutation 'R8111:Eml5'

630888

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.445) question?

Stock #

R8111 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 98792514 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000152709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057000] [ENSMUST00000065716] [ENSMUST00000110104] [ENSMUST00000110105] [ENSMUST00000223282]

Predicted Effect

probably benign
Transcript: ENSMUST00000057000

SMART Domains

Protein: ENSMUSP00000055879
Gene: ENSMUSG00000021012

Domain	Start	End	E-Value	Type
low complexity region	298	306	N/A	INTRINSIC
low complexity region	313	320	N/A	INTRINSIC
ZnF_C3H1	440	463	7.16e-1	SMART
ZnF_C3H1	465	484	5.27e1	SMART
ZnF_C3H1	520	542	5.55e0	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000065716

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110104

SMART Domains

Protein: ENSMUSP00000105731
Gene: ENSMUSG00000021012

Domain	Start	End	E-Value	Type
low complexity region	298	306	N/A	INTRINSIC
low complexity region	313	320	N/A	INTRINSIC
ZnF_C3H1	465	488	7.16e-1	SMART
ZnF_C3H1	490	509	5.27e1	SMART
ZnF_C3H1	545	567	5.55e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110105

SMART Domains

Protein: ENSMUSP00000105732
Gene: ENSMUSG00000021012

Domain	Start	End	E-Value	Type
low complexity region	298	306	N/A	INTRINSIC
low complexity region	313	320	N/A	INTRINSIC
ZnF_C3H1	596	619	7.16e-1	SMART
ZnF_C3H1	621	640	5.27e1	SMART
ZnF_C3H1	676	698	5.55e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000222097

Predicted Effect

probably null
Transcript: ENSMUST00000223282

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 93.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	C	T	14: 32,660,309	W1233*	probably null	Het
4930590J08Rik	A	G	6: 91,917,710	I247V	probably benign	Het
8030423J24Rik	T	A	13: 70,883,958	C50S	unknown	Het
Adam29	T	G	8: 55,871,550	H623P	probably benign	Het
Adamts5	A	G	16: 85,899,315	V318A	probably damaging	Het
Ano3	T	C	2: 110,783,713	D215G	possibly damaging	Het
Ap3b2	A	G	7: 81,463,782	I893T	unknown	Het
Apob	G	A	12: 8,008,801	A2428T	probably benign	Het
Armc3	T	C	2: 19,296,863	V660A	probably benign	Het
Atf7	G	T	15: 102,563,334	T42K	probably damaging	Het
Atg9a	A	T	1: 75,187,722	I160N	probably damaging	Het
Atp2b1	T	C	10: 98,996,924	V429A	possibly damaging	Het
Bpifb3	A	C	2: 153,922,689	H167P	probably benign	Het
Cacna1f	G	T	X: 7,621,087	E921D	probably damaging	Het
Ccdc57	T	A	11: 120,878,887	L713F	probably damaging	Het
Chd1l	C	T	3: 97,587,210	E385K	possibly damaging	Het
Csmd1	C	T	8: 15,917,306	V3186I	probably benign	Het
Dclre1c	T	A	2: 3,447,148	D349E	probably benign	Het
Dlg1	C	T	16: 31,842,802	T657M	possibly damaging	Het
Dync2h1	T	C	9: 7,148,688	I919V	probably benign	Het
Epas1	C	A	17: 86,818,432	S286*	probably null	Het
Fat1	G	A	8: 45,026,058	V2714I	possibly damaging	Het
Fuca2	T	C	10: 13,514,801	M447T	probably benign	Het
Gm10800	CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA	CAAGAAAACTGAAAATCA	2: 98,667,016		probably null	Het
Gm11110	A	C	17: 57,103,427	C24G	probably null	Het
Gm6176	T	A	7: 22,051,168	I113F	probably benign	Het
Gmcl1	G	T	6: 86,721,426	A163E	probably damaging	Het
Gpat2	G	T	2: 127,433,857	L518F	probably damaging	Het
Gpr137b	T	C	13: 13,359,406	Y355C	probably damaging	Het
Hgsnat	C	T	8: 25,968,412	V195I	probably benign	Het
Hivep3	T	A	4: 120,098,386	S1300T	probably damaging	Het
Hs3st2	A	T	7: 121,393,139	H137L	probably damaging	Het
Iffo1	T	C	6: 125,145,818	S188P	possibly damaging	Het
Itih1	T	C	14: 30,932,268	D684G	probably damaging	Het
Lrba	C	A	3: 86,327,705	N852K	probably damaging	Het
Lrriq4	T	C	3: 30,655,781	S425P	possibly damaging	Het
Mdn1	T	A	4: 32,674,003	S562T	possibly damaging	Het
Mex3a	T	C	3: 88,536,757	V380A	probably benign	Het
Mgat4d	A	T	8: 83,368,147	N271I	probably damaging	Het
Mmp24	T	A	2: 155,807,425	V254E	possibly damaging	Het
Muc16	T	A	9: 18,592,629	R6455S	possibly damaging	Het
Npffr1	T	A	10: 61,623,349	V127E	probably damaging	Het
Obox5	T	A	7: 15,758,616	N165K	probably damaging	Het
Olfr1513	G	A	14: 52,349,887	T53M	possibly damaging	Het
Otulin	A	C	15: 27,606,295	V344G	probably damaging	Het
Pappa	A	G	4: 65,261,992	D1030G	probably damaging	Het
Pdzd2	G	A	15: 12,373,506	S2181L	probably benign	Het
Ppp2r3c	C	A	12: 55,297,849	M111I	probably benign	Het
Prss37	T	C	6: 40,517,813	T13A	probably benign	Het
Sfi1	TCGC	TC	11: 3,146,254		probably null	Het
Sgo2b	T	A	8: 63,943,104	K39N	probably damaging	Het
Sike1	T	C	3: 103,001,807	*208Q	probably null	Het
Spire1	A	G	18: 67,519,321	S229P	probably damaging	Het
Tmem132b	A	G	5: 125,622,793	I132V	probably benign	Het
Umodl1	T	C	17: 30,971,818	V213A	probably damaging	Het
Washc1	C	G	17: 66,116,038	Q116E	probably benign	Het
Wdr34	C	A	2: 30,031,847	A501S	possibly damaging	Het
Zfp553	T	A	7: 127,236,921	C549*	probably null	Het
Zfp9	G	A	6: 118,464,600	P367L	probably damaging	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GCTCTAATGCACAGCAATAAAGG -3'
(R):5'- CAGATTTAGCCCAGATTCCCG -3'

Sequencing Primer
(F):5'- TCCTACTGAATGACGAGATCACGTG -3'
(R):5'- AGCCCAGATTCCCGGTATTTGG -3'

Posted On

2020-06-30