Incidental Mutation 'R8111:Olfr1513'
ID630893
Institutional Source Beutler Lab
Gene Symbol Olfr1513
Ensembl Gene ENSMUSG00000095030
Gene Nameolfactory receptor 1513
SynonymsMOR223-10, GA_x6K02T2RJGY-644134-645075, MOR223-7P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R8111 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location52347495-52356408 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 52349887 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 53 (T53M)
Ref Sequence ENSEMBL: ENSMUSP00000149216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089739] [ENSMUST00000215147]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089739
AA Change: T53M

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000087171
Gene: ENSMUSG00000095030
AA Change: T53M

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 5.2e-49 PFAM
Pfam:7tm_1 41 291 1.6e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215147
AA Change: T53M

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,660,309 W1233* probably null Het
4930590J08Rik A G 6: 91,917,710 I247V probably benign Het
8030423J24Rik T A 13: 70,883,958 C50S unknown Het
Adam29 T G 8: 55,871,550 H623P probably benign Het
Adamts5 A G 16: 85,899,315 V318A probably damaging Het
Ano3 T C 2: 110,783,713 D215G possibly damaging Het
Ap3b2 A G 7: 81,463,782 I893T unknown Het
Apob G A 12: 8,008,801 A2428T probably benign Het
Armc3 T C 2: 19,296,863 V660A probably benign Het
Atf7 G T 15: 102,563,334 T42K probably damaging Het
Atg9a A T 1: 75,187,722 I160N probably damaging Het
Atp2b1 T C 10: 98,996,924 V429A possibly damaging Het
Bpifb3 A C 2: 153,922,689 H167P probably benign Het
Cacna1f G T X: 7,621,087 E921D probably damaging Het
Ccdc57 T A 11: 120,878,887 L713F probably damaging Het
Chd1l C T 3: 97,587,210 E385K possibly damaging Het
Csmd1 C T 8: 15,917,306 V3186I probably benign Het
Dclre1c T A 2: 3,447,148 D349E probably benign Het
Dlg1 C T 16: 31,842,802 T657M possibly damaging Het
Dync2h1 T C 9: 7,148,688 I919V probably benign Het
Eml5 A G 12: 98,792,514 probably null Het
Epas1 C A 17: 86,818,432 S286* probably null Het
Fat1 G A 8: 45,026,058 V2714I possibly damaging Het
Fuca2 T C 10: 13,514,801 M447T probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm11110 A C 17: 57,103,427 C24G probably null Het
Gm6176 T A 7: 22,051,168 I113F probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpat2 G T 2: 127,433,857 L518F probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Hgsnat C T 8: 25,968,412 V195I probably benign Het
Hivep3 T A 4: 120,098,386 S1300T probably damaging Het
Hs3st2 A T 7: 121,393,139 H137L probably damaging Het
Iffo1 T C 6: 125,145,818 S188P possibly damaging Het
Itih1 T C 14: 30,932,268 D684G probably damaging Het
Lrba C A 3: 86,327,705 N852K probably damaging Het
Lrriq4 T C 3: 30,655,781 S425P possibly damaging Het
Mdn1 T A 4: 32,674,003 S562T possibly damaging Het
Mex3a T C 3: 88,536,757 V380A probably benign Het
Mgat4d A T 8: 83,368,147 N271I probably damaging Het
Mmp24 T A 2: 155,807,425 V254E possibly damaging Het
Muc16 T A 9: 18,592,629 R6455S possibly damaging Het
Npffr1 T A 10: 61,623,349 V127E probably damaging Het
Obox5 T A 7: 15,758,616 N165K probably damaging Het
Otulin A C 15: 27,606,295 V344G probably damaging Het
Pappa A G 4: 65,261,992 D1030G probably damaging Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Ppp2r3c C A 12: 55,297,849 M111I probably benign Het
Prss37 T C 6: 40,517,813 T13A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgo2b T A 8: 63,943,104 K39N probably damaging Het
Sike1 T C 3: 103,001,807 *208Q probably null Het
Spire1 A G 18: 67,519,321 S229P probably damaging Het
Tmem132b A G 5: 125,622,793 I132V probably benign Het
Umodl1 T C 17: 30,971,818 V213A probably damaging Het
Washc1 C G 17: 66,116,038 Q116E probably benign Het
Wdr34 C A 2: 30,031,847 A501S possibly damaging Het
Zfp553 T A 7: 127,236,921 C549* probably null Het
Zfp9 G A 6: 118,464,600 P367L probably damaging Het
Other mutations in Olfr1513
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Olfr1513 APN 14 52349710 missense probably benign 0.00
IGL02485:Olfr1513 APN 14 52350044 start codon destroyed possibly damaging 0.89
IGL02828:Olfr1513 APN 14 52349342 missense probably benign 0.02
R0744:Olfr1513 UTSW 14 52349378 missense probably benign 0.00
R0833:Olfr1513 UTSW 14 52349378 missense probably benign 0.00
R2316:Olfr1513 UTSW 14 52349938 missense probably benign 0.00
R4898:Olfr1513 UTSW 14 52349542 missense probably damaging 1.00
R5018:Olfr1513 UTSW 14 52349279 missense possibly damaging 0.81
R5134:Olfr1513 UTSW 14 52349791 missense probably benign 0.03
R5485:Olfr1513 UTSW 14 52349319 nonsense probably null
R6819:Olfr1513 UTSW 14 52349699 missense probably damaging 1.00
R6877:Olfr1513 UTSW 14 52349813 missense possibly damaging 0.95
R7583:Olfr1513 UTSW 14 52349903 missense possibly damaging 0.93
R7606:Olfr1513 UTSW 14 52349963 missense probably benign 0.33
R7653:Olfr1513 UTSW 14 52349432 nonsense probably null
R8262:Olfr1513 UTSW 14 52349168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACTGCCCAGAAAGTGGTAG -3'
(R):5'- TGCCCCAGGTTTTCACAGTC -3'

Sequencing Primer
(F):5'- GTAGAAATAAAGCTGAGCCACGCATC -3'
(R):5'- AGCTTGCACGTCATTTATGCTAAC -3'
Posted On2020-06-30