Incidental Mutation 'R8111:Dlg1'
ID630897
Institutional Source Beutler Lab
Gene Symbol Dlg1
Ensembl Gene ENSMUSG00000022770
Gene Namediscs large MAGUK scaffold protein 1
SynonymsDlgh1, B130052P05Rik, SAP97
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8111 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location31663443-31875129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31842802 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 657 (T657M)
Ref Sequence ENSEMBL: ENSMUSP00000064280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023454] [ENSMUST00000064477] [ENSMUST00000100001] [ENSMUST00000115196] [ENSMUST00000115201] [ENSMUST00000115205] [ENSMUST00000132176]
Predicted Effect probably benign
Transcript: ENSMUST00000023454
AA Change: T624M

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000023454
Gene: ENSMUSG00000022770
AA Change: T624M

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 190 4.33e-44 SMART
PDZ 199 278 5.98e-22 SMART
PDZ 294 373 1.94e-21 SMART
PDZ 441 514 1.84e-22 SMART
low complexity region 534 542 N/A INTRINSIC
SH3 551 617 1.27e-9 SMART
GuKc 681 860 1.54e-75 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000064477
AA Change: T657M

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064280
Gene: ENSMUSG00000022770
AA Change: T657M

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 736 915 1.54e-75 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100001
AA Change: T657M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097581
Gene: ENSMUSG00000022770
AA Change: T657M

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 714 893 1.54e-75 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115196
AA Change: T574M

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110850
Gene: ENSMUSG00000022770
AA Change: T574M

DomainStartEndE-ValueType
low complexity region 13 27 N/A INTRINSIC
MAGUK_N_PEST 30 140 1.81e-14 SMART
PDZ 149 228 5.98e-22 SMART
PDZ 244 323 1.94e-21 SMART
PDZ 391 464 1.84e-22 SMART
low complexity region 484 492 N/A INTRINSIC
SH3 501 567 1.27e-9 SMART
GuKc 643 822 1.54e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115201
AA Change: T657M

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110855
Gene: ENSMUSG00000022770
AA Change: T657M

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 721 900 1.54e-75 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115205
AA Change: T657M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110859
Gene: ENSMUSG00000022770
AA Change: T657M

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 223 6.07e-57 SMART
PDZ 232 311 5.98e-22 SMART
PDZ 327 406 1.94e-21 SMART
PDZ 474 547 1.84e-22 SMART
low complexity region 567 575 N/A INTRINSIC
SH3 584 650 1.27e-9 SMART
GuKc 714 893 1.54e-75 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130920
Predicted Effect
SMART Domains Protein: ENSMUSP00000115954
Gene: ENSMUSG00000022770
AA Change: T352M

DomainStartEndE-ValueType
PDZ 38 117 1.94e-21 SMART
PDZ 170 243 1.84e-22 SMART
low complexity region 263 271 N/A INTRINSIC
SH3 280 346 1.27e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132176
SMART Domains Protein: ENSMUSP00000138782
Gene: ENSMUSG00000022770

DomainStartEndE-ValueType
L27 7 67 7.33e-12 SMART
MAGUK_N_PEST 106 190 4.33e-44 SMART
PDZ 199 278 5.98e-22 SMART
PDZ 294 373 1.94e-21 SMART
PDZ 426 499 1.84e-22 SMART
low complexity region 519 527 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain scaffolding protein that is required for normal development. This protein may have a role in septate junction formation, signal transduction, cell proliferation, synaptogenesis and lymphocyte activation. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene, but the full-length nature of some of the variants is not known. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal lethality, craniofacial defects, and abnormal eye morphology. Mice homozygous for knock-out alleles exhibit neonatal lethality, kidney defects, reproductive organ morphology, and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,660,309 W1233* probably null Het
4930590J08Rik A G 6: 91,917,710 I247V probably benign Het
8030423J24Rik T A 13: 70,883,958 C50S unknown Het
Adam29 T G 8: 55,871,550 H623P probably benign Het
Adamts5 A G 16: 85,899,315 V318A probably damaging Het
Ano3 T C 2: 110,783,713 D215G possibly damaging Het
Ap3b2 A G 7: 81,463,782 I893T unknown Het
Apob G A 12: 8,008,801 A2428T probably benign Het
Armc3 T C 2: 19,296,863 V660A probably benign Het
Atf7 G T 15: 102,563,334 T42K probably damaging Het
Atg9a A T 1: 75,187,722 I160N probably damaging Het
Atp2b1 T C 10: 98,996,924 V429A possibly damaging Het
Bpifb3 A C 2: 153,922,689 H167P probably benign Het
Cacna1f G T X: 7,621,087 E921D probably damaging Het
Ccdc57 T A 11: 120,878,887 L713F probably damaging Het
Chd1l C T 3: 97,587,210 E385K possibly damaging Het
Csmd1 C T 8: 15,917,306 V3186I probably benign Het
Dclre1c T A 2: 3,447,148 D349E probably benign Het
Dync2h1 T C 9: 7,148,688 I919V probably benign Het
Eml5 A G 12: 98,792,514 probably null Het
Epas1 C A 17: 86,818,432 S286* probably null Het
Fat1 G A 8: 45,026,058 V2714I possibly damaging Het
Fuca2 T C 10: 13,514,801 M447T probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm11110 A C 17: 57,103,427 C24G probably null Het
Gm6176 T A 7: 22,051,168 I113F probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpat2 G T 2: 127,433,857 L518F probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Hgsnat C T 8: 25,968,412 V195I probably benign Het
Hivep3 T A 4: 120,098,386 S1300T probably damaging Het
Hs3st2 A T 7: 121,393,139 H137L probably damaging Het
Iffo1 T C 6: 125,145,818 S188P possibly damaging Het
Itih1 T C 14: 30,932,268 D684G probably damaging Het
Lrba C A 3: 86,327,705 N852K probably damaging Het
Lrriq4 T C 3: 30,655,781 S425P possibly damaging Het
Mdn1 T A 4: 32,674,003 S562T possibly damaging Het
Mex3a T C 3: 88,536,757 V380A probably benign Het
Mgat4d A T 8: 83,368,147 N271I probably damaging Het
Mmp24 T A 2: 155,807,425 V254E possibly damaging Het
Muc16 T A 9: 18,592,629 R6455S possibly damaging Het
Npffr1 T A 10: 61,623,349 V127E probably damaging Het
Obox5 T A 7: 15,758,616 N165K probably damaging Het
Olfr1513 G A 14: 52,349,887 T53M possibly damaging Het
Otulin A C 15: 27,606,295 V344G probably damaging Het
Pappa A G 4: 65,261,992 D1030G probably damaging Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Ppp2r3c C A 12: 55,297,849 M111I probably benign Het
Prss37 T C 6: 40,517,813 T13A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgo2b T A 8: 63,943,104 K39N probably damaging Het
Sike1 T C 3: 103,001,807 *208Q probably null Het
Spire1 A G 18: 67,519,321 S229P probably damaging Het
Tmem132b A G 5: 125,622,793 I132V probably benign Het
Umodl1 T C 17: 30,971,818 V213A probably damaging Het
Washc1 C G 17: 66,116,038 Q116E probably benign Het
Wdr34 C A 2: 30,031,847 A501S possibly damaging Het
Zfp553 T A 7: 127,236,921 C549* probably null Het
Zfp9 G A 6: 118,464,600 P367L probably damaging Het
Other mutations in Dlg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01604:Dlg1 APN 16 31856438 splice site probably benign
IGL02277:Dlg1 APN 16 31790264 missense probably damaging 1.00
IGL02897:Dlg1 APN 16 31771856 critical splice donor site probably null
IGL03025:Dlg1 APN 16 31805727 missense probably benign 0.00
IGL03271:Dlg1 APN 16 31857892 missense possibly damaging 0.94
PIT4812001:Dlg1 UTSW 16 31846885 missense probably benign 0.01
R0068:Dlg1 UTSW 16 31836200 unclassified probably benign
R0115:Dlg1 UTSW 16 31805690 nonsense probably null
R0128:Dlg1 UTSW 16 31858065 critical splice donor site probably null
R0257:Dlg1 UTSW 16 31842853 splice site probably benign
R0268:Dlg1 UTSW 16 31684193 missense probably benign
R0312:Dlg1 UTSW 16 31790267 missense probably benign
R0321:Dlg1 UTSW 16 31858036 missense probably damaging 1.00
R0355:Dlg1 UTSW 16 31684174 nonsense probably null
R0538:Dlg1 UTSW 16 31796864 critical splice acceptor site probably null
R0540:Dlg1 UTSW 16 31838174 missense possibly damaging 0.90
R0607:Dlg1 UTSW 16 31665580 missense probably benign 0.37
R0607:Dlg1 UTSW 16 31838174 missense possibly damaging 0.90
R0894:Dlg1 UTSW 16 31743147 missense probably benign 0.03
R1107:Dlg1 UTSW 16 31846916 missense probably benign 0.00
R1349:Dlg1 UTSW 16 31812820 missense probably damaging 1.00
R1372:Dlg1 UTSW 16 31812820 missense probably damaging 1.00
R1468:Dlg1 UTSW 16 31842822 splice site probably null
R1468:Dlg1 UTSW 16 31842822 splice site probably null
R1696:Dlg1 UTSW 16 31781798 missense probably damaging 0.96
R1772:Dlg1 UTSW 16 31665667 missense possibly damaging 0.75
R1795:Dlg1 UTSW 16 31743147 missense probably benign 0.03
R2106:Dlg1 UTSW 16 31812756 missense probably damaging 1.00
R2206:Dlg1 UTSW 16 31853846 missense probably benign 0.18
R2207:Dlg1 UTSW 16 31853846 missense probably benign 0.18
R2846:Dlg1 UTSW 16 31863197 missense probably damaging 1.00
R3954:Dlg1 UTSW 16 31858008 missense probably damaging 1.00
R4714:Dlg1 UTSW 16 31790261 missense probably damaging 1.00
R4758:Dlg1 UTSW 16 31791752 missense possibly damaging 0.92
R4898:Dlg1 UTSW 16 31857946 missense probably damaging 1.00
R4964:Dlg1 UTSW 16 31754808 missense probably benign 0.21
R4966:Dlg1 UTSW 16 31754808 missense probably benign 0.21
R4985:Dlg1 UTSW 16 31788135 splice site probably null
R5068:Dlg1 UTSW 16 31684295 critical splice donor site probably null
R5069:Dlg1 UTSW 16 31684295 critical splice donor site probably null
R5078:Dlg1 UTSW 16 31856469 nonsense probably null
R5090:Dlg1 UTSW 16 31838084 missense probably damaging 1.00
R5225:Dlg1 UTSW 16 31836267 missense probably benign 0.21
R5888:Dlg1 UTSW 16 31791886 critical splice donor site probably null
R5950:Dlg1 UTSW 16 31665583 missense probably damaging 1.00
R6029:Dlg1 UTSW 16 31793570 missense probably damaging 1.00
R6132:Dlg1 UTSW 16 31836241 missense possibly damaging 0.93
R6246:Dlg1 UTSW 16 31665650 missense probably benign 0.00
R6294:Dlg1 UTSW 16 31838124 missense probably damaging 1.00
R6322:Dlg1 UTSW 16 31856479 missense probably damaging 1.00
R7147:Dlg1 UTSW 16 31791854 missense probably benign
R7216:Dlg1 UTSW 16 31796918 frame shift probably null
R7963:Dlg1 UTSW 16 31790301 missense probably null 0.92
R7985:Dlg1 UTSW 16 31788105 nonsense probably null
R8041:Dlg1 UTSW 16 31838067 missense possibly damaging 0.91
X0021:Dlg1 UTSW 16 31665708 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGTAAACTGTAGACTTAGTGGG -3'
(R):5'- GGCCTGCAGAATAGGTTCCTT -3'

Sequencing Primer
(F):5'- CTTACACACAGGTATGCATGCATG -3'
(R):5'- CCTGCAGAATAGGTTCCTTATAGTG -3'
Posted On2020-06-30