Incidental Mutation 'R8111:Adamts5'
ID630898
Institutional Source Beutler Lab
Gene Symbol Adamts5
Ensembl Gene ENSMUSG00000022894
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)
Synonyms9530092O11Rik, ADAM-TS5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R8111 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location85856173-85901828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85899315 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 318 (V318A)
Ref Sequence ENSEMBL: ENSMUSP00000023611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023611]
Predicted Effect probably damaging
Transcript: ENSMUST00000023611
AA Change: V318A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894
AA Change: V318A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 182 9.1e-18 PFAM
low complexity region 226 232 N/A INTRINSIC
Pfam:Reprolysin_5 265 450 2.1e-16 PFAM
Pfam:Reprolysin_4 265 472 4.8e-14 PFAM
Pfam:Reprolysin 267 476 4.6e-26 PFAM
Pfam:Reprolysin_2 286 466 3.7e-13 PFAM
Pfam:Reprolysin_3 288 421 6.9e-17 PFAM
Blast:ACR 477 555 4e-15 BLAST
low complexity region 556 566 N/A INTRINSIC
TSP1 570 622 6.04e-13 SMART
Pfam:ADAM_spacer1 732 852 1.7e-35 PFAM
TSP1 878 926 7.12e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,660,309 W1233* probably null Het
4930590J08Rik A G 6: 91,917,710 I247V probably benign Het
8030423J24Rik T A 13: 70,883,958 C50S unknown Het
Adam29 T G 8: 55,871,550 H623P probably benign Het
Ano3 T C 2: 110,783,713 D215G possibly damaging Het
Ap3b2 A G 7: 81,463,782 I893T unknown Het
Apob G A 12: 8,008,801 A2428T probably benign Het
Armc3 T C 2: 19,296,863 V660A probably benign Het
Atf7 G T 15: 102,563,334 T42K probably damaging Het
Atg9a A T 1: 75,187,722 I160N probably damaging Het
Atp2b1 T C 10: 98,996,924 V429A possibly damaging Het
Bpifb3 A C 2: 153,922,689 H167P probably benign Het
Cacna1f G T X: 7,621,087 E921D probably damaging Het
Ccdc57 T A 11: 120,878,887 L713F probably damaging Het
Chd1l C T 3: 97,587,210 E385K possibly damaging Het
Csmd1 C T 8: 15,917,306 V3186I probably benign Het
Dclre1c T A 2: 3,447,148 D349E probably benign Het
Dlg1 C T 16: 31,842,802 T657M possibly damaging Het
Dync2h1 T C 9: 7,148,688 I919V probably benign Het
Eml5 A G 12: 98,792,514 probably null Het
Epas1 C A 17: 86,818,432 S286* probably null Het
Fat1 G A 8: 45,026,058 V2714I possibly damaging Het
Fuca2 T C 10: 13,514,801 M447T probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm11110 A C 17: 57,103,427 C24G probably null Het
Gm6176 T A 7: 22,051,168 I113F probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpat2 G T 2: 127,433,857 L518F probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Hgsnat C T 8: 25,968,412 V195I probably benign Het
Hivep3 T A 4: 120,098,386 S1300T probably damaging Het
Hs3st2 A T 7: 121,393,139 H137L probably damaging Het
Iffo1 T C 6: 125,145,818 S188P possibly damaging Het
Itih1 T C 14: 30,932,268 D684G probably damaging Het
Lrba C A 3: 86,327,705 N852K probably damaging Het
Lrriq4 T C 3: 30,655,781 S425P possibly damaging Het
Mdn1 T A 4: 32,674,003 S562T possibly damaging Het
Mex3a T C 3: 88,536,757 V380A probably benign Het
Mgat4d A T 8: 83,368,147 N271I probably damaging Het
Mmp24 T A 2: 155,807,425 V254E possibly damaging Het
Muc16 T A 9: 18,592,629 R6455S possibly damaging Het
Npffr1 T A 10: 61,623,349 V127E probably damaging Het
Obox5 T A 7: 15,758,616 N165K probably damaging Het
Olfr1513 G A 14: 52,349,887 T53M possibly damaging Het
Otulin A C 15: 27,606,295 V344G probably damaging Het
Pappa A G 4: 65,261,992 D1030G probably damaging Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Ppp2r3c C A 12: 55,297,849 M111I probably benign Het
Prss37 T C 6: 40,517,813 T13A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgo2b T A 8: 63,943,104 K39N probably damaging Het
Sike1 T C 3: 103,001,807 *208Q probably null Het
Spire1 A G 18: 67,519,321 S229P probably damaging Het
Tmem132b A G 5: 125,622,793 I132V probably benign Het
Umodl1 T C 17: 30,971,818 V213A probably damaging Het
Washc1 C G 17: 66,116,038 Q116E probably benign Het
Wdr34 C A 2: 30,031,847 A501S possibly damaging Het
Zfp553 T A 7: 127,236,921 C549* probably null Het
Zfp9 G A 6: 118,464,600 P367L probably damaging Het
Other mutations in Adamts5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Adamts5 APN 16 85899834 missense probably damaging 1.00
IGL01070:Adamts5 APN 16 85863133 missense probably damaging 1.00
IGL01321:Adamts5 APN 16 85899475 missense probably benign 0.03
IGL01616:Adamts5 APN 16 85887814 splice site probably null
IGL02551:Adamts5 APN 16 85870038 missense possibly damaging 0.71
IGL03263:Adamts5 APN 16 85869942 missense probably damaging 0.99
IGL03295:Adamts5 APN 16 85877945 missense probably damaging 1.00
IGL03393:Adamts5 APN 16 85868195 missense probably damaging 0.99
IGL03403:Adamts5 APN 16 85863014 missense probably damaging 0.97
R0414:Adamts5 UTSW 16 85877906 missense probably damaging 1.00
R0419:Adamts5 UTSW 16 85866642 missense probably benign 0.00
R0539:Adamts5 UTSW 16 85868692 missense probably damaging 1.00
R0570:Adamts5 UTSW 16 85899247 missense probably damaging 1.00
R0574:Adamts5 UTSW 16 85899484 missense probably damaging 0.99
R0669:Adamts5 UTSW 16 85899726 missense probably benign 0.45
R1454:Adamts5 UTSW 16 85869993 missense possibly damaging 0.88
R1498:Adamts5 UTSW 16 85900102 missense possibly damaging 0.63
R1729:Adamts5 UTSW 16 85877915 nonsense probably null
R1753:Adamts5 UTSW 16 85899352 missense probably damaging 1.00
R1784:Adamts5 UTSW 16 85877915 nonsense probably null
R1906:Adamts5 UTSW 16 85868685 nonsense probably null
R1946:Adamts5 UTSW 16 85899243 missense probably damaging 1.00
R2180:Adamts5 UTSW 16 85887924 missense probably damaging 1.00
R2223:Adamts5 UTSW 16 85899306 missense probably damaging 1.00
R2366:Adamts5 UTSW 16 85862758 missense probably damaging 1.00
R3889:Adamts5 UTSW 16 85868121 missense probably damaging 1.00
R4214:Adamts5 UTSW 16 85868643 missense probably damaging 1.00
R4909:Adamts5 UTSW 16 85900066 nonsense probably null
R5119:Adamts5 UTSW 16 85899578 missense probably benign 0.00
R5230:Adamts5 UTSW 16 85870068 missense probably damaging 0.97
R5452:Adamts5 UTSW 16 85869912 critical splice donor site probably null
R5652:Adamts5 UTSW 16 85899268 missense probably damaging 1.00
R5831:Adamts5 UTSW 16 85868118 missense probably damaging 1.00
R6045:Adamts5 UTSW 16 85899300 missense probably damaging 0.99
R6259:Adamts5 UTSW 16 85899753 missense probably benign 0.03
R6384:Adamts5 UTSW 16 85862828 missense probably benign 0.00
R6724:Adamts5 UTSW 16 85868557 missense probably benign 0.06
R6829:Adamts5 UTSW 16 85870071 missense possibly damaging 0.52
R7066:Adamts5 UTSW 16 85862764 missense probably damaging 1.00
R7256:Adamts5 UTSW 16 85863035 missense probably damaging 1.00
R7293:Adamts5 UTSW 16 85899945 missense probably benign 0.10
R7298:Adamts5 UTSW 16 85899918 missense probably benign 0.35
R7384:Adamts5 UTSW 16 85899826 missense probably benign 0.02
R7452:Adamts5 UTSW 16 85877981 missense probably benign 0.00
R7727:Adamts5 UTSW 16 85899966 missense probably damaging 1.00
R7785:Adamts5 UTSW 16 85863004 missense probably damaging 0.99
R7894:Adamts5 UTSW 16 85877920 nonsense probably null
R8370:Adamts5 UTSW 16 85899993 missense possibly damaging 0.74
X0062:Adamts5 UTSW 16 85863157 missense probably damaging 1.00
Z1177:Adamts5 UTSW 16 85870074 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTCTTTGTATCCCAGGG -3'
(R):5'- TTTCTCGCCATCTGGGAACG -3'

Sequencing Primer
(F):5'- TCCCCTAGCTGGTTATGT -3'
(R):5'- ACCTCAGACTTGGTGGAGG -3'
Posted On2020-06-30