Incidental Mutation 'R8111:Epas1'
ID630902
Institutional Source Beutler Lab
Gene Symbol Epas1
Ensembl Gene ENSMUSG00000024140
Gene Nameendothelial PAS domain protein 1
SynonymsHIF-2alpha, HRF, HLF, bHLHe73, hypoxia inducible transcription factor 2alpha, HIF2A, MOP2, Hif like protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8111 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location86753907-86833410 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 86818432 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 286 (S286*)
Ref Sequence ENSEMBL: ENSMUSP00000024954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024954]
Predicted Effect probably null
Transcript: ENSMUST00000024954
AA Change: S286*
SMART Domains Protein: ENSMUSP00000024954
Gene: ENSMUSG00000024140
AA Change: S286*

DomainStartEndE-ValueType
HLH 20 75 3.98e-9 SMART
PAS 86 152 6.39e-9 SMART
PAS 232 298 6.75e-8 SMART
PAC 304 347 5.56e-9 SMART
low complexity region 464 484 N/A INTRINSIC
Pfam:HIF-1 516 548 4.9e-21 PFAM
low complexity region 725 737 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
Pfam:HIF-1a_CTAD 837 873 3.6e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor involved in the induction of genes regulated by oxygen, which is induced as oxygen levels fall. The encoded protein contains a basic-helix-loop-helix domain protein dimerization domain as well as a domain found in proteins in signal transduction pathways which respond to oxygen levels. Mutations in this gene are associated with erythrocytosis familial type 4. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for null mutations display prenatal, neonatal or postnatal lethality. For some alleles lethality is associated with vascular abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik C T 14: 32,660,309 W1233* probably null Het
4930590J08Rik A G 6: 91,917,710 I247V probably benign Het
8030423J24Rik T A 13: 70,883,958 C50S unknown Het
Adam29 T G 8: 55,871,550 H623P probably benign Het
Adamts5 A G 16: 85,899,315 V318A probably damaging Het
Ano3 T C 2: 110,783,713 D215G possibly damaging Het
Ap3b2 A G 7: 81,463,782 I893T unknown Het
Apob G A 12: 8,008,801 A2428T probably benign Het
Armc3 T C 2: 19,296,863 V660A probably benign Het
Atf7 G T 15: 102,563,334 T42K probably damaging Het
Atg9a A T 1: 75,187,722 I160N probably damaging Het
Atp2b1 T C 10: 98,996,924 V429A possibly damaging Het
Bpifb3 A C 2: 153,922,689 H167P probably benign Het
Cacna1f G T X: 7,621,087 E921D probably damaging Het
Ccdc57 T A 11: 120,878,887 L713F probably damaging Het
Chd1l C T 3: 97,587,210 E385K possibly damaging Het
Csmd1 C T 8: 15,917,306 V3186I probably benign Het
Dclre1c T A 2: 3,447,148 D349E probably benign Het
Dlg1 C T 16: 31,842,802 T657M possibly damaging Het
Dync2h1 T C 9: 7,148,688 I919V probably benign Het
Eml5 A G 12: 98,792,514 probably null Het
Fat1 G A 8: 45,026,058 V2714I possibly damaging Het
Fuca2 T C 10: 13,514,801 M447T probably benign Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm11110 A C 17: 57,103,427 C24G probably null Het
Gm6176 T A 7: 22,051,168 I113F probably benign Het
Gmcl1 G T 6: 86,721,426 A163E probably damaging Het
Gpat2 G T 2: 127,433,857 L518F probably damaging Het
Gpr137b T C 13: 13,359,406 Y355C probably damaging Het
Hgsnat C T 8: 25,968,412 V195I probably benign Het
Hivep3 T A 4: 120,098,386 S1300T probably damaging Het
Hs3st2 A T 7: 121,393,139 H137L probably damaging Het
Iffo1 T C 6: 125,145,818 S188P possibly damaging Het
Itih1 T C 14: 30,932,268 D684G probably damaging Het
Lrba C A 3: 86,327,705 N852K probably damaging Het
Lrriq4 T C 3: 30,655,781 S425P possibly damaging Het
Mdn1 T A 4: 32,674,003 S562T possibly damaging Het
Mex3a T C 3: 88,536,757 V380A probably benign Het
Mgat4d A T 8: 83,368,147 N271I probably damaging Het
Mmp24 T A 2: 155,807,425 V254E possibly damaging Het
Muc16 T A 9: 18,592,629 R6455S possibly damaging Het
Npffr1 T A 10: 61,623,349 V127E probably damaging Het
Obox5 T A 7: 15,758,616 N165K probably damaging Het
Olfr1513 G A 14: 52,349,887 T53M possibly damaging Het
Otulin A C 15: 27,606,295 V344G probably damaging Het
Pappa A G 4: 65,261,992 D1030G probably damaging Het
Pdzd2 G A 15: 12,373,506 S2181L probably benign Het
Ppp2r3c C A 12: 55,297,849 M111I probably benign Het
Prss37 T C 6: 40,517,813 T13A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgo2b T A 8: 63,943,104 K39N probably damaging Het
Sike1 T C 3: 103,001,807 *208Q probably null Het
Spire1 A G 18: 67,519,321 S229P probably damaging Het
Tmem132b A G 5: 125,622,793 I132V probably benign Het
Umodl1 T C 17: 30,971,818 V213A probably damaging Het
Washc1 C G 17: 66,116,038 Q116E probably benign Het
Wdr34 C A 2: 30,031,847 A501S possibly damaging Het
Zfp553 T A 7: 127,236,921 C549* probably null Het
Zfp9 G A 6: 118,464,600 P367L probably damaging Het
Other mutations in Epas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01934:Epas1 APN 17 86823729 missense probably damaging 1.00
IGL02150:Epas1 APN 17 86805289 missense probably damaging 1.00
IGL02221:Epas1 APN 17 86827847 missense possibly damaging 0.50
IGL02555:Epas1 APN 17 86829064 missense probably benign
IGL02739:Epas1 APN 17 86805282 missense probably damaging 0.98
IGL03389:Epas1 APN 17 86823703 missense probably benign 0.10
R0043:Epas1 UTSW 17 86823812 missense probably damaging 0.99
R0363:Epas1 UTSW 17 86805848 splice site probably benign
R0399:Epas1 UTSW 17 86805193 missense probably benign 0.01
R0737:Epas1 UTSW 17 86829456 missense possibly damaging 0.45
R1542:Epas1 UTSW 17 86824490 missense possibly damaging 0.67
R1662:Epas1 UTSW 17 86829027 missense probably damaging 0.99
R1885:Epas1 UTSW 17 86805295 missense probably damaging 1.00
R2197:Epas1 UTSW 17 86829043 missense probably benign 0.01
R3056:Epas1 UTSW 17 86830981 missense probably damaging 0.99
R4342:Epas1 UTSW 17 86823800 missense probably damaging 1.00
R4391:Epas1 UTSW 17 86809663 missense probably benign 0.00
R4774:Epas1 UTSW 17 86805758 missense probably damaging 1.00
R4798:Epas1 UTSW 17 86805839 missense probably benign
R4989:Epas1 UTSW 17 86809454 missense probably damaging 1.00
R5133:Epas1 UTSW 17 86809454 missense probably damaging 1.00
R5604:Epas1 UTSW 17 86805772 missense probably damaging 1.00
R5811:Epas1 UTSW 17 86823775 missense probably damaging 1.00
R5838:Epas1 UTSW 17 86823686 missense possibly damaging 0.94
R5885:Epas1 UTSW 17 86827544 missense probably damaging 1.00
R5932:Epas1 UTSW 17 86827646 missense possibly damaging 0.66
R6045:Epas1 UTSW 17 86809399 missense probably damaging 0.99
R6145:Epas1 UTSW 17 86829429 missense probably benign 0.01
R7517:Epas1 UTSW 17 86831098 missense possibly damaging 0.92
R7552:Epas1 UTSW 17 86829043 missense probably benign 0.01
R7828:Epas1 UTSW 17 86827699 missense probably benign 0.04
R8081:Epas1 UTSW 17 86829369 missense probably benign
Z1176:Epas1 UTSW 17 86827946 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGTGACGATACTTGATACATTCACC -3'
(R):5'- AACCATCTGCGAGGACTCAAG -3'

Sequencing Primer
(F):5'- ACCTTAGATCCTGAAGTCTCTGATCG -3'
(R):5'- TTGCATAAACGCCATTTAGGG -3'
Posted On2020-06-30