Incidental Mutation 'R8112:Emc1'
ID 630914
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene Name ER membrane protein complex subunit 1
Synonyms C230096C10Rik
MMRRC Submission 067541-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R8112 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 139079898-139106041 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 139094498 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 684 (R684W)
Ref Sequence ENSEMBL: ENSMUSP00000080888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
AlphaFold Q8C7X2
Predicted Effect probably benign
Transcript: ENSMUST00000042096
AA Change: R681W

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: R681W

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082262
AA Change: R684W

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: R684W

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect probably benign
Transcript: ENSMUST00000179784
AA Change: R684W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: R684W

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,264,624 (GRCm39) V3002A probably benign Het
Aifm3 T C 16: 17,320,804 (GRCm39) V422A probably damaging Het
Alx3 G T 3: 107,512,300 (GRCm39) E313* probably null Het
Arfgef3 A G 10: 18,528,379 (GRCm39) V336A possibly damaging Het
Art5 A T 7: 101,747,218 (GRCm39) V187E probably benign Het
Atxn1 A G 13: 45,721,433 (GRCm39) V154A probably benign Het
B3galt1 A G 2: 67,948,702 (GRCm39) D139G probably damaging Het
Cbx5 A G 15: 103,108,171 (GRCm39) V158A probably benign Het
Cdca7l T C 12: 117,840,779 (GRCm39) probably null Het
Cecr2 T C 6: 120,739,175 (GRCm39) S1301P probably benign Het
Chmp3 T A 6: 71,538,012 (GRCm39) S80T probably benign Het
Cyp2g1 T A 7: 26,518,886 (GRCm39) D427E probably benign Het
Depdc5 G A 5: 33,126,050 (GRCm39) V1199I possibly damaging Het
Efcab3 T C 11: 104,841,026 (GRCm39) V3643A unknown Het
Ehmt1 G T 2: 24,753,396 (GRCm39) L335M probably damaging Het
Elfn2 A G 15: 78,557,635 (GRCm39) V304A probably damaging Het
Eme2 A T 17: 25,113,809 (GRCm39) V72E probably damaging Het
Gen1 T A 12: 11,304,374 (GRCm39) K230* probably null Het
Gfap T A 11: 102,787,928 (GRCm39) I6F probably benign Het
Grid2 T C 6: 63,885,891 (GRCm39) S96P probably damaging Het
H2-M2 A G 17: 37,794,383 (GRCm39) L13P unknown Het
Hps4 T G 5: 112,517,977 (GRCm39) C323W probably benign Het
Ing3 A G 6: 21,952,181 (GRCm39) K52E probably damaging Het
Ippk C T 13: 49,599,818 (GRCm39) P226S Het
Klhl3 C T 13: 58,161,677 (GRCm39) V473M possibly damaging Het
Krt4 T A 15: 101,828,724 (GRCm39) N380I probably damaging Het
Lrp1 A T 10: 127,441,715 (GRCm39) C174S probably damaging Het
Lrrc8e T C 8: 4,285,575 (GRCm39) I600T probably benign Het
Malt1 T C 18: 65,582,680 (GRCm39) probably null Het
Mindy1 T C 3: 95,202,122 (GRCm39) L333P probably damaging Het
Mrgprb1 A G 7: 48,097,682 (GRCm39) S77P probably damaging Het
Mtus2 G T 5: 148,013,713 (GRCm39) E169* probably null Het
Muc5b A G 7: 141,415,765 (GRCm39) T2904A possibly damaging Het
Noxa1 C T 2: 24,982,553 (GRCm39) probably null Het
Ogfod3 G A 11: 121,095,376 (GRCm39) R5W probably damaging Het
Or4f59 T A 2: 111,872,982 (GRCm39) I132F probably damaging Het
Or7g35 T A 9: 19,496,020 (GRCm39) F62L probably benign Het
Or9i16 A G 19: 13,864,753 (GRCm39) S274P probably damaging Het
Pgm3 C A 9: 86,446,828 (GRCm39) R230L probably benign Het
Plpbp A G 8: 27,536,069 (GRCm39) I121V unknown Het
Prl8a9 T C 13: 27,743,355 (GRCm39) D150G probably benign Het
Psapl1 A G 5: 36,362,919 (GRCm39) N504D probably benign Het
Ptchd4 A C 17: 42,814,066 (GRCm39) N656H probably benign Het
Ptprs A T 17: 56,741,532 (GRCm39) Y577* probably null Het
Rasgef1c A G 11: 49,858,228 (GRCm39) Y263C probably damaging Het
Rinl A G 7: 28,490,014 (GRCm39) probably null Het
Scd4 T C 19: 44,325,945 (GRCm39) F100L probably benign Het
Scgb2b20 T G 7: 33,063,969 (GRCm39) R100S probably benign Het
Scn8a C T 15: 100,927,718 (GRCm39) A1399V probably benign Het
Slc22a7 A G 17: 46,747,756 (GRCm39) V267A probably benign Het
Slc7a11 T C 3: 50,372,440 (GRCm39) E263G possibly damaging Het
Slmap A G 14: 26,143,703 (GRCm39) L728P probably damaging Het
Smarcb1 A T 10: 75,745,986 (GRCm39) probably null Het
Sspn T C 6: 145,901,361 (GRCm39) V80A possibly damaging Het
Tasor2 A T 13: 3,619,516 (GRCm39) D2238E probably damaging Het
Terb1 T C 8: 105,195,399 (GRCm39) T581A probably benign Het
Themis A G 10: 28,673,502 (GRCm39) *596W probably null Het
Thoc2l T C 5: 104,669,501 (GRCm39) F1341S probably benign Het
Trac T C 14: 54,460,557 (GRCm39) probably benign Het
Trim37 T C 11: 87,109,093 (GRCm39) F940S possibly damaging Het
Trpa1 T C 1: 14,974,490 (GRCm39) T231A probably benign Het
Ttn T C 2: 76,580,529 (GRCm39) I23455V probably benign Het
Wap G T 11: 6,586,724 (GRCm39) T125K probably benign Het
Wdfy4 G A 14: 32,826,072 (GRCm39) P1193L Het
Zfp85 T C 13: 67,896,893 (GRCm39) D393G possibly damaging Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139,082,393 (GRCm39) splice site probably benign
IGL00898:Emc1 APN 4 139,098,941 (GRCm39) missense probably damaging 1.00
IGL01481:Emc1 APN 4 139,089,410 (GRCm39) missense probably benign 0.00
IGL02174:Emc1 APN 4 139,098,979 (GRCm39) missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139,102,775 (GRCm39) missense probably damaging 1.00
IGL02501:Emc1 APN 4 139,098,295 (GRCm39) missense probably benign 0.00
IGL02697:Emc1 APN 4 139,079,955 (GRCm39) missense probably benign
IGL03355:Emc1 APN 4 139,098,904 (GRCm39) splice site probably benign
IGL03386:Emc1 APN 4 139,091,092 (GRCm39) critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139,086,588 (GRCm39) missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0023:Emc1 UTSW 4 139,098,320 (GRCm39) missense probably damaging 1.00
R0051:Emc1 UTSW 4 139,102,474 (GRCm39) missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.99
R0613:Emc1 UTSW 4 139,102,383 (GRCm39) splice site probably benign
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1464:Emc1 UTSW 4 139,098,248 (GRCm39) missense probably damaging 0.97
R1512:Emc1 UTSW 4 139,087,495 (GRCm39) splice site probably null
R1702:Emc1 UTSW 4 139,102,512 (GRCm39) missense probably damaging 1.00
R1839:Emc1 UTSW 4 139,087,796 (GRCm39) missense probably damaging 0.98
R1843:Emc1 UTSW 4 139,102,823 (GRCm39) missense probably benign 0.02
R1850:Emc1 UTSW 4 139,086,684 (GRCm39) splice site probably benign
R2024:Emc1 UTSW 4 139,088,257 (GRCm39) missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139,093,841 (GRCm39) missense probably benign 0.08
R2912:Emc1 UTSW 4 139,092,571 (GRCm39) missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139,092,697 (GRCm39) missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139,090,496 (GRCm39) nonsense probably null
R4738:Emc1 UTSW 4 139,089,513 (GRCm39) missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139,102,476 (GRCm39) nonsense probably null
R5033:Emc1 UTSW 4 139,099,007 (GRCm39) missense probably damaging 1.00
R5322:Emc1 UTSW 4 139,081,557 (GRCm39) missense probably damaging 1.00
R5375:Emc1 UTSW 4 139,093,802 (GRCm39) missense probably damaging 0.96
R5483:Emc1 UTSW 4 139,102,687 (GRCm39) missense probably damaging 1.00
R5587:Emc1 UTSW 4 139,089,459 (GRCm39) missense probably damaging 0.98
R5687:Emc1 UTSW 4 139,102,691 (GRCm39) missense probably damaging 1.00
R5938:Emc1 UTSW 4 139,084,931 (GRCm39) missense probably benign
R6056:Emc1 UTSW 4 139,081,533 (GRCm39) missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139,093,689 (GRCm39) missense probably benign 0.01
R6174:Emc1 UTSW 4 139,093,842 (GRCm39) missense probably benign 0.01
R6208:Emc1 UTSW 4 139,081,582 (GRCm39) missense probably damaging 0.99
R6340:Emc1 UTSW 4 139,092,874 (GRCm39) missense probably damaging 1.00
R6371:Emc1 UTSW 4 139,098,976 (GRCm39) nonsense probably null
R6889:Emc1 UTSW 4 139,092,661 (GRCm39) missense probably damaging 0.97
R7592:Emc1 UTSW 4 139,087,877 (GRCm39) missense probably benign 0.00
R7699:Emc1 UTSW 4 139,082,181 (GRCm39) missense probably benign
R7715:Emc1 UTSW 4 139,098,934 (GRCm39) missense probably damaging 1.00
R7984:Emc1 UTSW 4 139,102,760 (GRCm39) missense probably damaging 1.00
R8325:Emc1 UTSW 4 139,092,521 (GRCm39) missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139,088,600 (GRCm39) missense probably benign
R8751:Emc1 UTSW 4 139,097,279 (GRCm39) missense possibly damaging 0.58
R9032:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9085:Emc1 UTSW 4 139,094,474 (GRCm39) missense possibly damaging 0.91
R9474:Emc1 UTSW 4 139,093,705 (GRCm39) missense probably damaging 0.98
R9482:Emc1 UTSW 4 139,088,201 (GRCm39) missense probably damaging 0.96
R9610:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
R9611:Emc1 UTSW 4 139,091,035 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GCCTTAGATAGACCCAGTGAC -3'
(R):5'- CCTCCTCAGAGCAGAATGAC -3'

Sequencing Primer
(F):5'- GATAGACCCAGTGACTTGTTTTATC -3'
(R):5'- GAGCAGAATGACACACCCTTTG -3'
Posted On 2020-06-30