Incidental Mutation 'R8112:Emc1'
ID630914
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene NameER membrane protein complex subunit 1
SynonymsC230096C10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R8112 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location139352587-139378730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 139367187 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 684 (R684W)
Ref Sequence ENSEMBL: ENSMUSP00000080888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
Predicted Effect probably benign
Transcript: ENSMUST00000042096
AA Change: R681W

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: R681W

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082262
AA Change: R684W

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: R684W

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect probably benign
Transcript: ENSMUST00000179784
AA Change: R684W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: R684W

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,314,624 V3002A probably benign Het
Aifm3 T C 16: 17,502,940 V422A probably damaging Het
Alx3 G T 3: 107,604,984 E313* probably null Het
Arfgef3 A G 10: 18,652,631 V336A possibly damaging Het
Art5 A T 7: 102,098,011 V187E probably benign Het
Atxn1 A G 13: 45,567,957 V154A probably benign Het
B3galt1 A G 2: 68,118,358 D139G probably damaging Het
BC005561 T C 5: 104,521,635 F1341S probably benign Het
Cbx5 A G 15: 103,199,744 V158A probably benign Het
Cdca7l T C 12: 117,877,044 probably null Het
Cecr2 T C 6: 120,762,214 S1301P probably benign Het
Chmp3 T A 6: 71,561,028 S80T probably benign Het
Cyp2g1 T A 7: 26,819,461 D427E probably benign Het
Depdc5 G A 5: 32,968,706 V1199I possibly damaging Het
Ehmt1 G T 2: 24,863,384 L335M probably damaging Het
Elfn2 A G 15: 78,673,435 V304A probably damaging Het
Eme2 A T 17: 24,894,835 V72E probably damaging Het
Fam208b A T 13: 3,569,516 D2238E probably damaging Het
Gen1 T A 12: 11,254,373 K230* probably null Het
Gfap T A 11: 102,897,102 I6F probably benign Het
Gm11639 T C 11: 104,950,200 V3643A unknown Het
Grid2 T C 6: 63,908,907 S96P probably damaging Het
H2-M2 A G 17: 37,483,492 L13P unknown Het
Hps4 T G 5: 112,370,111 C323W probably benign Het
Ing3 A G 6: 21,952,182 K52E probably damaging Het
Ippk C T 13: 49,446,342 P226S Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Krt4 T A 15: 101,920,289 N380I probably damaging Het
Lrp1 A T 10: 127,605,846 C174S probably damaging Het
Lrrc8e T C 8: 4,235,575 I600T probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Mindy1 T C 3: 95,294,811 L333P probably damaging Het
Mrgprb1 A G 7: 48,447,934 S77P probably damaging Het
Mtus2 G T 5: 148,076,903 E169* probably null Het
Muc5b A G 7: 141,862,028 T2904A possibly damaging Het
Noxa1 C T 2: 25,092,541 probably null Het
Ogfod3 G A 11: 121,204,550 R5W probably damaging Het
Olfr1312 T A 2: 112,042,637 I132F probably damaging Het
Olfr1504 A G 19: 13,887,389 S274P probably damaging Het
Olfr855 T A 9: 19,584,724 F62L probably benign Het
Pgm3 C A 9: 86,564,775 R230L probably benign Het
Plpbp A G 8: 27,046,041 I121V unknown Het
Prl8a9 T C 13: 27,559,372 D150G probably benign Het
Psapl1 A G 5: 36,205,575 N504D probably benign Het
Ptchd4 A C 17: 42,503,175 N656H probably benign Het
Ptprs A T 17: 56,434,532 Y577* probably null Het
Rasgef1c A G 11: 49,967,401 Y263C probably damaging Het
Rinl A G 7: 28,790,589 probably null Het
Scd4 T C 19: 44,337,506 F100L probably benign Het
Scgb2b20 T G 7: 33,364,544 R100S probably benign Het
Scn8a C T 15: 101,029,837 A1399V probably benign Het
Slc22a7 A G 17: 46,436,830 V267A probably benign Het
Slc7a11 T C 3: 50,417,991 E263G possibly damaging Het
Slmap A G 14: 26,422,548 L728P probably damaging Het
Smarcb1 A T 10: 75,910,152 probably null Het
Sspn T C 6: 145,955,635 V80A possibly damaging Het
Terb1 T C 8: 104,468,767 T581A probably benign Het
Themis A G 10: 28,797,506 *596W probably null Het
Trac T C 14: 54,223,100 probably benign Het
Trim37 T C 11: 87,218,267 F940S possibly damaging Het
Trpa1 T C 1: 14,904,266 T231A probably benign Het
Ttn T C 2: 76,750,185 I23455V probably benign Het
Wap G T 11: 6,636,724 T125K probably benign Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Zfp85 T C 13: 67,748,774 D393G possibly damaging Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139355082 splice site probably benign
IGL00898:Emc1 APN 4 139371630 missense probably damaging 1.00
IGL01481:Emc1 APN 4 139362099 missense probably benign 0.00
IGL02174:Emc1 APN 4 139371668 missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139375464 missense probably damaging 1.00
IGL02501:Emc1 APN 4 139370984 missense probably benign 0.00
IGL02697:Emc1 APN 4 139352644 missense probably benign
IGL03355:Emc1 APN 4 139371593 splice site probably benign
IGL03386:Emc1 APN 4 139363781 critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139359277 missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0051:Emc1 UTSW 4 139375163 missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139360485 missense probably damaging 0.99
R0613:Emc1 UTSW 4 139375072 splice site probably benign
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1512:Emc1 UTSW 4 139360184 splice site probably null
R1702:Emc1 UTSW 4 139375201 missense probably damaging 1.00
R1839:Emc1 UTSW 4 139360485 missense probably damaging 0.98
R1843:Emc1 UTSW 4 139375512 missense probably benign 0.02
R1850:Emc1 UTSW 4 139359373 splice site probably benign
R2024:Emc1 UTSW 4 139360946 missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139366530 missense probably benign 0.08
R2912:Emc1 UTSW 4 139365260 missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139363185 nonsense probably null
R4738:Emc1 UTSW 4 139362202 missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139375165 nonsense probably null
R5033:Emc1 UTSW 4 139371696 missense probably damaging 1.00
R5322:Emc1 UTSW 4 139354246 missense probably damaging 1.00
R5375:Emc1 UTSW 4 139366491 missense probably damaging 0.96
R5483:Emc1 UTSW 4 139375376 missense probably damaging 1.00
R5587:Emc1 UTSW 4 139362148 missense probably damaging 0.98
R5687:Emc1 UTSW 4 139375380 missense probably damaging 1.00
R5938:Emc1 UTSW 4 139357620 missense probably benign
R6056:Emc1 UTSW 4 139354222 missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139366378 missense probably benign 0.01
R6174:Emc1 UTSW 4 139366531 missense probably benign 0.01
R6208:Emc1 UTSW 4 139354271 missense probably damaging 0.99
R6340:Emc1 UTSW 4 139365563 missense probably damaging 1.00
R6371:Emc1 UTSW 4 139371665 nonsense probably null
R6889:Emc1 UTSW 4 139365350 missense probably damaging 0.97
R7592:Emc1 UTSW 4 139360566 missense probably benign 0.00
R7699:Emc1 UTSW 4 139354870 missense probably benign
R7715:Emc1 UTSW 4 139371623 missense probably damaging 1.00
R7984:Emc1 UTSW 4 139375449 missense probably damaging 1.00
R8325:Emc1 UTSW 4 139365210 missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139361289 missense probably benign
R8751:Emc1 UTSW 4 139369968 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GCCTTAGATAGACCCAGTGAC -3'
(R):5'- CCTCCTCAGAGCAGAATGAC -3'

Sequencing Primer
(F):5'- GATAGACCCAGTGACTTGTTTTATC -3'
(R):5'- GAGCAGAATGACACACCCTTTG -3'
Posted On2020-06-30