Incidental Mutation 'R8112:Depdc5'
ID 630915
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene Name DEP domain containing 5
Synonyms
MMRRC Submission 067541-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8112 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 33021045-33151580 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 33126050 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 1199 (V1199I)
Ref Sequence ENSEMBL: ENSMUSP00000113862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087897] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000124780] [ENSMUST00000130461]
AlphaFold P61460
Predicted Effect possibly damaging
Transcript: ENSMUST00000087897
AA Change: V1208I

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: V1208I

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119705
AA Change: V1199I

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: V1199I

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120902
AA Change: V1177I

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: V1177I

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124780
AA Change: V561I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000120120
Gene: ENSMUSG00000037426
AA Change: V561I

DomainStartEndE-ValueType
low complexity region 179 189 N/A INTRINSIC
low complexity region 347 359 N/A INTRINSIC
SCOP:d1fsha_ 519 586 1e-13 SMART
Blast:DEP 537 589 2e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000130461
SMART Domains Protein: ENSMUSP00000118681
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
low complexity region 70 82 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000137169
AA Change: V583I

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121089
Gene: ENSMUSG00000037426
AA Change: V583I

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
low complexity region 88 97 N/A INTRINSIC
low complexity region 224 234 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 535 551 N/A INTRINSIC
DEP 560 635 2.49e-15 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 896 910 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,264,624 (GRCm39) V3002A probably benign Het
Aifm3 T C 16: 17,320,804 (GRCm39) V422A probably damaging Het
Alx3 G T 3: 107,512,300 (GRCm39) E313* probably null Het
Arfgef3 A G 10: 18,528,379 (GRCm39) V336A possibly damaging Het
Art5 A T 7: 101,747,218 (GRCm39) V187E probably benign Het
Atxn1 A G 13: 45,721,433 (GRCm39) V154A probably benign Het
B3galt1 A G 2: 67,948,702 (GRCm39) D139G probably damaging Het
Cbx5 A G 15: 103,108,171 (GRCm39) V158A probably benign Het
Cdca7l T C 12: 117,840,779 (GRCm39) probably null Het
Cecr2 T C 6: 120,739,175 (GRCm39) S1301P probably benign Het
Chmp3 T A 6: 71,538,012 (GRCm39) S80T probably benign Het
Cyp2g1 T A 7: 26,518,886 (GRCm39) D427E probably benign Het
Efcab3 T C 11: 104,841,026 (GRCm39) V3643A unknown Het
Ehmt1 G T 2: 24,753,396 (GRCm39) L335M probably damaging Het
Elfn2 A G 15: 78,557,635 (GRCm39) V304A probably damaging Het
Emc1 C T 4: 139,094,498 (GRCm39) R684W probably benign Het
Eme2 A T 17: 25,113,809 (GRCm39) V72E probably damaging Het
Gen1 T A 12: 11,304,374 (GRCm39) K230* probably null Het
Gfap T A 11: 102,787,928 (GRCm39) I6F probably benign Het
Grid2 T C 6: 63,885,891 (GRCm39) S96P probably damaging Het
H2-M2 A G 17: 37,794,383 (GRCm39) L13P unknown Het
Hps4 T G 5: 112,517,977 (GRCm39) C323W probably benign Het
Ing3 A G 6: 21,952,181 (GRCm39) K52E probably damaging Het
Ippk C T 13: 49,599,818 (GRCm39) P226S Het
Klhl3 C T 13: 58,161,677 (GRCm39) V473M possibly damaging Het
Krt4 T A 15: 101,828,724 (GRCm39) N380I probably damaging Het
Lrp1 A T 10: 127,441,715 (GRCm39) C174S probably damaging Het
Lrrc8e T C 8: 4,285,575 (GRCm39) I600T probably benign Het
Malt1 T C 18: 65,582,680 (GRCm39) probably null Het
Mindy1 T C 3: 95,202,122 (GRCm39) L333P probably damaging Het
Mrgprb1 A G 7: 48,097,682 (GRCm39) S77P probably damaging Het
Mtus2 G T 5: 148,013,713 (GRCm39) E169* probably null Het
Muc5b A G 7: 141,415,765 (GRCm39) T2904A possibly damaging Het
Noxa1 C T 2: 24,982,553 (GRCm39) probably null Het
Ogfod3 G A 11: 121,095,376 (GRCm39) R5W probably damaging Het
Or4f59 T A 2: 111,872,982 (GRCm39) I132F probably damaging Het
Or7g35 T A 9: 19,496,020 (GRCm39) F62L probably benign Het
Or9i16 A G 19: 13,864,753 (GRCm39) S274P probably damaging Het
Pgm3 C A 9: 86,446,828 (GRCm39) R230L probably benign Het
Plpbp A G 8: 27,536,069 (GRCm39) I121V unknown Het
Prl8a9 T C 13: 27,743,355 (GRCm39) D150G probably benign Het
Psapl1 A G 5: 36,362,919 (GRCm39) N504D probably benign Het
Ptchd4 A C 17: 42,814,066 (GRCm39) N656H probably benign Het
Ptprs A T 17: 56,741,532 (GRCm39) Y577* probably null Het
Rasgef1c A G 11: 49,858,228 (GRCm39) Y263C probably damaging Het
Rinl A G 7: 28,490,014 (GRCm39) probably null Het
Scd4 T C 19: 44,325,945 (GRCm39) F100L probably benign Het
Scgb2b20 T G 7: 33,063,969 (GRCm39) R100S probably benign Het
Scn8a C T 15: 100,927,718 (GRCm39) A1399V probably benign Het
Slc22a7 A G 17: 46,747,756 (GRCm39) V267A probably benign Het
Slc7a11 T C 3: 50,372,440 (GRCm39) E263G possibly damaging Het
Slmap A G 14: 26,143,703 (GRCm39) L728P probably damaging Het
Smarcb1 A T 10: 75,745,986 (GRCm39) probably null Het
Sspn T C 6: 145,901,361 (GRCm39) V80A possibly damaging Het
Tasor2 A T 13: 3,619,516 (GRCm39) D2238E probably damaging Het
Terb1 T C 8: 105,195,399 (GRCm39) T581A probably benign Het
Themis A G 10: 28,673,502 (GRCm39) *596W probably null Het
Thoc2l T C 5: 104,669,501 (GRCm39) F1341S probably benign Het
Trac T C 14: 54,460,557 (GRCm39) probably benign Het
Trim37 T C 11: 87,109,093 (GRCm39) F940S possibly damaging Het
Trpa1 T C 1: 14,974,490 (GRCm39) T231A probably benign Het
Ttn T C 2: 76,580,529 (GRCm39) I23455V probably benign Het
Wap G T 11: 6,586,724 (GRCm39) T125K probably benign Het
Wdfy4 G A 14: 32,826,072 (GRCm39) P1193L Het
Zfp85 T C 13: 67,896,893 (GRCm39) D393G possibly damaging Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 33,125,158 (GRCm39) splice site probably null
IGL01019:Depdc5 APN 5 33,050,745 (GRCm39) missense probably damaging 0.96
IGL01067:Depdc5 APN 5 33,056,411 (GRCm39) splice site probably null
IGL01405:Depdc5 APN 5 33,095,033 (GRCm39) missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 33,113,241 (GRCm39) missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 33,081,544 (GRCm39) missense probably damaging 1.00
IGL01998:Depdc5 APN 5 33,102,495 (GRCm39) splice site probably benign
IGL02025:Depdc5 APN 5 33,103,976 (GRCm39) critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 33,061,145 (GRCm39) missense probably damaging 1.00
IGL02537:Depdc5 APN 5 33,125,131 (GRCm39) missense probably damaging 1.00
IGL02812:Depdc5 APN 5 33,050,712 (GRCm39) splice site probably benign
IGL03001:Depdc5 APN 5 33,102,434 (GRCm39) missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 33,026,157 (GRCm39) unclassified probably benign
alligator UTSW 5 33,121,851 (GRCm39) splice site probably null
lagarto UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
sauros UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
IGL02988:Depdc5 UTSW 5 33,113,511 (GRCm39) splice site probably null
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0153:Depdc5 UTSW 5 33,091,281 (GRCm39) splice site probably benign
R0179:Depdc5 UTSW 5 33,058,918 (GRCm39) unclassified probably benign
R0212:Depdc5 UTSW 5 33,069,586 (GRCm39) missense probably benign 0.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0302:Depdc5 UTSW 5 33,061,890 (GRCm39) critical splice donor site probably benign
R0511:Depdc5 UTSW 5 33,102,372 (GRCm39) nonsense probably null
R0677:Depdc5 UTSW 5 33,058,814 (GRCm39) missense probably damaging 1.00
R0884:Depdc5 UTSW 5 33,075,322 (GRCm39) missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 33,034,418 (GRCm39) missense probably damaging 1.00
R1611:Depdc5 UTSW 5 33,148,297 (GRCm39) missense probably damaging 1.00
R1687:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 33,075,286 (GRCm39) missense probably benign 0.24
R1903:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 33,061,175 (GRCm39) missense probably damaging 1.00
R1997:Depdc5 UTSW 5 33,059,250 (GRCm39) critical splice donor site probably null
R2079:Depdc5 UTSW 5 33,104,018 (GRCm39) missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 33,148,125 (GRCm39) nonsense probably null
R2291:Depdc5 UTSW 5 33,136,746 (GRCm39) missense probably damaging 1.00
R2422:Depdc5 UTSW 5 33,148,379 (GRCm39) missense probably damaging 1.00
R2851:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2852:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2937:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2938:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2974:Depdc5 UTSW 5 33,091,361 (GRCm39) critical splice donor site probably null
R3884:Depdc5 UTSW 5 33,101,421 (GRCm39) missense probably damaging 1.00
R3967:Depdc5 UTSW 5 33,101,459 (GRCm39) nonsense probably null
R4118:Depdc5 UTSW 5 33,121,979 (GRCm39) missense probably damaging 1.00
R4197:Depdc5 UTSW 5 33,148,547 (GRCm39) missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 33,061,878 (GRCm39) critical splice donor site probably null
R4534:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 33,141,290 (GRCm39) missense probably damaging 1.00
R4613:Depdc5 UTSW 5 33,132,790 (GRCm39) missense probably damaging 1.00
R4736:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4738:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4765:Depdc5 UTSW 5 33,094,979 (GRCm39) missense probably damaging 1.00
R5021:Depdc5 UTSW 5 33,136,758 (GRCm39) missense probably damaging 1.00
R5259:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5261:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5541:Depdc5 UTSW 5 33,021,973 (GRCm39) utr 5 prime probably benign
R5594:Depdc5 UTSW 5 33,058,834 (GRCm39) missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 33,132,850 (GRCm39) nonsense probably null
R6132:Depdc5 UTSW 5 33,067,811 (GRCm39) missense probably damaging 0.99
R6146:Depdc5 UTSW 5 33,126,075 (GRCm39) missense probably benign 0.01
R6336:Depdc5 UTSW 5 33,121,851 (GRCm39) splice site probably null
R6468:Depdc5 UTSW 5 33,069,575 (GRCm39) missense probably benign 0.02
R6911:Depdc5 UTSW 5 33,081,536 (GRCm39) missense probably damaging 1.00
R6969:Depdc5 UTSW 5 33,141,204 (GRCm39) missense probably damaging 1.00
R7002:Depdc5 UTSW 5 33,034,502 (GRCm39) splice site probably null
R7066:Depdc5 UTSW 5 33,059,192 (GRCm39) missense probably benign 0.08
R7231:Depdc5 UTSW 5 33,059,209 (GRCm39) missense possibly damaging 0.92
R7264:Depdc5 UTSW 5 33,125,089 (GRCm39) missense probably benign
R7302:Depdc5 UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
R7386:Depdc5 UTSW 5 33,085,280 (GRCm39) missense probably benign
R7564:Depdc5 UTSW 5 33,058,854 (GRCm39) missense probably damaging 1.00
R7636:Depdc5 UTSW 5 33,075,327 (GRCm39) missense probably benign
R7795:Depdc5 UTSW 5 33,101,447 (GRCm39) missense probably damaging 1.00
R7845:Depdc5 UTSW 5 33,061,259 (GRCm39) splice site probably null
R8013:Depdc5 UTSW 5 33,131,186 (GRCm39) missense probably benign 0.01
R8037:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8038:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8065:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8067:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8108:Depdc5 UTSW 5 33,102,393 (GRCm39) missense probably benign 0.01
R8213:Depdc5 UTSW 5 33,094,981 (GRCm39) missense probably damaging 1.00
R8382:Depdc5 UTSW 5 33,085,242 (GRCm39) missense probably benign 0.00
R8680:Depdc5 UTSW 5 33,101,382 (GRCm39) missense possibly damaging 0.48
R8743:Depdc5 UTSW 5 33,081,587 (GRCm39) missense probably benign 0.10
R8754:Depdc5 UTSW 5 33,136,881 (GRCm39) missense probably benign 0.00
R9157:Depdc5 UTSW 5 33,102,452 (GRCm39) missense probably damaging 0.98
R9364:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9441:Depdc5 UTSW 5 33,095,042 (GRCm39) missense probably benign 0.03
R9450:Depdc5 UTSW 5 33,091,354 (GRCm39) missense probably benign
R9459:Depdc5 UTSW 5 33,148,117 (GRCm39) missense probably damaging 0.99
R9554:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9569:Depdc5 UTSW 5 33,025,321 (GRCm39) missense probably damaging 0.98
R9647:Depdc5 UTSW 5 33,081,567 (GRCm39) missense possibly damaging 0.94
R9688:Depdc5 UTSW 5 33,055,276 (GRCm39) nonsense probably null
X0027:Depdc5 UTSW 5 33,061,636 (GRCm39) missense probably damaging 1.00
Z1176:Depdc5 UTSW 5 33,100,626 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GTTCTTCTATCATGCCATGGGG -3'
(R):5'- GTATTCAAAGGCAGACCCAGC -3'

Sequencing Primer
(F):5'- CTATCATGCCATGGGGGTTTCTC -3'
(R):5'- GTCTGGTAAAAACAGATCCTCATCTC -3'
Posted On 2020-06-30