Incidental Mutation 'R8112:Mrgprb1'
ID 630928
Institutional Source Beutler Lab
Gene Symbol Mrgprb1
Ensembl Gene ENSMUSG00000070547
Gene Name MAS-related GPR, member B1
Synonyms MrgB1
MMRRC Submission 067541-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.048) question?
Stock # R8112 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 48093861-48106090 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 48097682 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 77 (S77P)
Ref Sequence ENSEMBL: ENSMUSP00000091946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094384] [ENSMUST00000188095] [ENSMUST00000188918]
AlphaFold Q3UG61
Predicted Effect probably damaging
Transcript: ENSMUST00000094384
AA Change: S77P

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091946
Gene: ENSMUSG00000070547
AA Change: S77P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 50 227 5.5e-11 PFAM
Pfam:7tm_1 59 290 4.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188095
Predicted Effect probably damaging
Transcript: ENSMUST00000188918
AA Change: S77P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140432
Gene: ENSMUSG00000070547
AA Change: S77P

DomainStartEndE-ValueType
SCOP:d1l9ha_ 23 84 3e-6 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,264,624 (GRCm39) V3002A probably benign Het
Aifm3 T C 16: 17,320,804 (GRCm39) V422A probably damaging Het
Alx3 G T 3: 107,512,300 (GRCm39) E313* probably null Het
Arfgef3 A G 10: 18,528,379 (GRCm39) V336A possibly damaging Het
Art5 A T 7: 101,747,218 (GRCm39) V187E probably benign Het
Atxn1 A G 13: 45,721,433 (GRCm39) V154A probably benign Het
B3galt1 A G 2: 67,948,702 (GRCm39) D139G probably damaging Het
Cbx5 A G 15: 103,108,171 (GRCm39) V158A probably benign Het
Cdca7l T C 12: 117,840,779 (GRCm39) probably null Het
Cecr2 T C 6: 120,739,175 (GRCm39) S1301P probably benign Het
Chmp3 T A 6: 71,538,012 (GRCm39) S80T probably benign Het
Cyp2g1 T A 7: 26,518,886 (GRCm39) D427E probably benign Het
Depdc5 G A 5: 33,126,050 (GRCm39) V1199I possibly damaging Het
Efcab3 T C 11: 104,841,026 (GRCm39) V3643A unknown Het
Ehmt1 G T 2: 24,753,396 (GRCm39) L335M probably damaging Het
Elfn2 A G 15: 78,557,635 (GRCm39) V304A probably damaging Het
Emc1 C T 4: 139,094,498 (GRCm39) R684W probably benign Het
Eme2 A T 17: 25,113,809 (GRCm39) V72E probably damaging Het
Gen1 T A 12: 11,304,374 (GRCm39) K230* probably null Het
Gfap T A 11: 102,787,928 (GRCm39) I6F probably benign Het
Grid2 T C 6: 63,885,891 (GRCm39) S96P probably damaging Het
H2-M2 A G 17: 37,794,383 (GRCm39) L13P unknown Het
Hps4 T G 5: 112,517,977 (GRCm39) C323W probably benign Het
Ing3 A G 6: 21,952,181 (GRCm39) K52E probably damaging Het
Ippk C T 13: 49,599,818 (GRCm39) P226S Het
Klhl3 C T 13: 58,161,677 (GRCm39) V473M possibly damaging Het
Krt4 T A 15: 101,828,724 (GRCm39) N380I probably damaging Het
Lrp1 A T 10: 127,441,715 (GRCm39) C174S probably damaging Het
Lrrc8e T C 8: 4,285,575 (GRCm39) I600T probably benign Het
Malt1 T C 18: 65,582,680 (GRCm39) probably null Het
Mindy1 T C 3: 95,202,122 (GRCm39) L333P probably damaging Het
Mtus2 G T 5: 148,013,713 (GRCm39) E169* probably null Het
Muc5b A G 7: 141,415,765 (GRCm39) T2904A possibly damaging Het
Noxa1 C T 2: 24,982,553 (GRCm39) probably null Het
Ogfod3 G A 11: 121,095,376 (GRCm39) R5W probably damaging Het
Or4f59 T A 2: 111,872,982 (GRCm39) I132F probably damaging Het
Or7g35 T A 9: 19,496,020 (GRCm39) F62L probably benign Het
Or9i16 A G 19: 13,864,753 (GRCm39) S274P probably damaging Het
Pgm3 C A 9: 86,446,828 (GRCm39) R230L probably benign Het
Plpbp A G 8: 27,536,069 (GRCm39) I121V unknown Het
Prl8a9 T C 13: 27,743,355 (GRCm39) D150G probably benign Het
Psapl1 A G 5: 36,362,919 (GRCm39) N504D probably benign Het
Ptchd4 A C 17: 42,814,066 (GRCm39) N656H probably benign Het
Ptprs A T 17: 56,741,532 (GRCm39) Y577* probably null Het
Rasgef1c A G 11: 49,858,228 (GRCm39) Y263C probably damaging Het
Rinl A G 7: 28,490,014 (GRCm39) probably null Het
Scd4 T C 19: 44,325,945 (GRCm39) F100L probably benign Het
Scgb2b20 T G 7: 33,063,969 (GRCm39) R100S probably benign Het
Scn8a C T 15: 100,927,718 (GRCm39) A1399V probably benign Het
Slc22a7 A G 17: 46,747,756 (GRCm39) V267A probably benign Het
Slc7a11 T C 3: 50,372,440 (GRCm39) E263G possibly damaging Het
Slmap A G 14: 26,143,703 (GRCm39) L728P probably damaging Het
Smarcb1 A T 10: 75,745,986 (GRCm39) probably null Het
Sspn T C 6: 145,901,361 (GRCm39) V80A possibly damaging Het
Tasor2 A T 13: 3,619,516 (GRCm39) D2238E probably damaging Het
Terb1 T C 8: 105,195,399 (GRCm39) T581A probably benign Het
Themis A G 10: 28,673,502 (GRCm39) *596W probably null Het
Thoc2l T C 5: 104,669,501 (GRCm39) F1341S probably benign Het
Trac T C 14: 54,460,557 (GRCm39) probably benign Het
Trim37 T C 11: 87,109,093 (GRCm39) F940S possibly damaging Het
Trpa1 T C 1: 14,974,490 (GRCm39) T231A probably benign Het
Ttn T C 2: 76,580,529 (GRCm39) I23455V probably benign Het
Wap G T 11: 6,586,724 (GRCm39) T125K probably benign Het
Wdfy4 G A 14: 32,826,072 (GRCm39) P1193L Het
Zfp85 T C 13: 67,896,893 (GRCm39) D393G possibly damaging Het
Other mutations in Mrgprb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Mrgprb1 APN 7 48,097,291 (GRCm39) missense probably damaging 0.99
IGL01141:Mrgprb1 APN 7 48,097,775 (GRCm39) missense probably benign 0.36
IGL01393:Mrgprb1 APN 7 48,097,754 (GRCm39) missense possibly damaging 0.48
IGL02430:Mrgprb1 APN 7 48,097,409 (GRCm39) missense possibly damaging 0.95
IGL02485:Mrgprb1 APN 7 48,097,465 (GRCm39) missense possibly damaging 0.88
R0026:Mrgprb1 UTSW 7 48,096,952 (GRCm39) missense possibly damaging 0.66
R0051:Mrgprb1 UTSW 7 48,096,962 (GRCm39) missense probably benign 0.01
R0789:Mrgprb1 UTSW 7 48,105,932 (GRCm39) splice site probably benign
R1223:Mrgprb1 UTSW 7 48,097,435 (GRCm39) missense possibly damaging 0.61
R1327:Mrgprb1 UTSW 7 48,097,177 (GRCm39) missense possibly damaging 0.87
R1456:Mrgprb1 UTSW 7 48,097,777 (GRCm39) missense probably damaging 0.98
R1561:Mrgprb1 UTSW 7 48,096,873 (GRCm39) splice site probably null
R1567:Mrgprb1 UTSW 7 48,097,201 (GRCm39) missense probably damaging 0.97
R2030:Mrgprb1 UTSW 7 48,097,076 (GRCm39) missense possibly damaging 0.83
R2165:Mrgprb1 UTSW 7 48,097,070 (GRCm39) missense probably benign 0.00
R2885:Mrgprb1 UTSW 7 48,097,469 (GRCm39) missense probably damaging 1.00
R3108:Mrgprb1 UTSW 7 48,097,076 (GRCm39) missense possibly damaging 0.93
R3919:Mrgprb1 UTSW 7 48,097,829 (GRCm39) missense probably benign 0.03
R4021:Mrgprb1 UTSW 7 48,096,871 (GRCm39) missense possibly damaging 0.95
R4613:Mrgprb1 UTSW 7 48,097,456 (GRCm39) missense possibly damaging 0.91
R4809:Mrgprb1 UTSW 7 48,097,739 (GRCm39) missense possibly damaging 0.89
R5249:Mrgprb1 UTSW 7 48,097,225 (GRCm39) missense possibly damaging 0.91
R5425:Mrgprb1 UTSW 7 48,097,719 (GRCm39) missense possibly damaging 0.81
R5555:Mrgprb1 UTSW 7 48,097,523 (GRCm39) missense probably benign 0.06
R5595:Mrgprb1 UTSW 7 48,097,432 (GRCm39) missense probably damaging 0.99
R5982:Mrgprb1 UTSW 7 48,097,568 (GRCm39) missense probably benign 0.01
R6746:Mrgprb1 UTSW 7 48,097,645 (GRCm39) missense possibly damaging 0.82
R7066:Mrgprb1 UTSW 7 48,097,424 (GRCm39) missense probably benign 0.27
R7141:Mrgprb1 UTSW 7 48,097,435 (GRCm39) missense possibly damaging 0.61
R7633:Mrgprb1 UTSW 7 48,097,331 (GRCm39) missense probably benign 0.01
R8072:Mrgprb1 UTSW 7 48,097,895 (GRCm39) nonsense probably null
R8080:Mrgprb1 UTSW 7 48,096,658 (GRCm39) splice site probably null
R8493:Mrgprb1 UTSW 7 48,097,321 (GRCm39) missense probably damaging 0.99
R8817:Mrgprb1 UTSW 7 48,097,070 (GRCm39) missense probably benign 0.01
R9135:Mrgprb1 UTSW 7 48,097,046 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCTAATGACAGTGAGGATGC -3'
(R):5'- TTGCAGAACTGAGATTGCACC -3'

Sequencing Primer
(F):5'- CAGTGAGGATGCTCAGACCAC -3'
(R):5'- CTCCTGAAAATGGACTTAGTCATCC -3'
Posted On 2020-06-30