Incidental Mutation 'R8112:Olfr855'
ID 630934
Institutional Source Beutler Lab
Gene Symbol Olfr855
Ensembl Gene ENSMUSG00000043087
Gene Name olfactory receptor 855
Synonyms MOR148-1, GA_x6K02T2PVTD-13330461-13331399
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock # R8112 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 19582617-19586030 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19584724 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 62 (F62L)
Ref Sequence ENSEMBL: ENSMUSP00000150218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061693] [ENSMUST00000215587]
AlphaFold Q7TRF8
Predicted Effect probably benign
Transcript: ENSMUST00000061693
AA Change: F62L

PolyPhen 2 Score 0.443 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000054790
Gene: ENSMUSG00000043087
AA Change: F62L

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 1.7e-54 PFAM
Pfam:7TM_GPCR_Srsx 37 182 5.2e-8 PFAM
Pfam:7tm_1 43 292 2.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215587
AA Change: F62L

PolyPhen 2 Score 0.443 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,314,624 V3002A probably benign Het
Aifm3 T C 16: 17,502,940 V422A probably damaging Het
Alx3 G T 3: 107,604,984 E313* probably null Het
Arfgef3 A G 10: 18,652,631 V336A possibly damaging Het
Art5 A T 7: 102,098,011 V187E probably benign Het
Atxn1 A G 13: 45,567,957 V154A probably benign Het
B3galt1 A G 2: 68,118,358 D139G probably damaging Het
BC005561 T C 5: 104,521,635 F1341S probably benign Het
Cbx5 A G 15: 103,199,744 V158A probably benign Het
Cdca7l T C 12: 117,877,044 probably null Het
Cecr2 T C 6: 120,762,214 S1301P probably benign Het
Chmp3 T A 6: 71,561,028 S80T probably benign Het
Cyp2g1 T A 7: 26,819,461 D427E probably benign Het
Depdc5 G A 5: 32,968,706 V1199I possibly damaging Het
Ehmt1 G T 2: 24,863,384 L335M probably damaging Het
Elfn2 A G 15: 78,673,435 V304A probably damaging Het
Emc1 C T 4: 139,367,187 R684W probably benign Het
Eme2 A T 17: 24,894,835 V72E probably damaging Het
Fam208b A T 13: 3,569,516 D2238E probably damaging Het
Gen1 T A 12: 11,254,373 K230* probably null Het
Gfap T A 11: 102,897,102 I6F probably benign Het
Gm11639 T C 11: 104,950,200 V3643A unknown Het
Grid2 T C 6: 63,908,907 S96P probably damaging Het
H2-M2 A G 17: 37,483,492 L13P unknown Het
Hps4 T G 5: 112,370,111 C323W probably benign Het
Ing3 A G 6: 21,952,182 K52E probably damaging Het
Ippk C T 13: 49,446,342 P226S Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Krt4 T A 15: 101,920,289 N380I probably damaging Het
Lrp1 A T 10: 127,605,846 C174S probably damaging Het
Lrrc8e T C 8: 4,235,575 I600T probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Mindy1 T C 3: 95,294,811 L333P probably damaging Het
Mrgprb1 A G 7: 48,447,934 S77P probably damaging Het
Mtus2 G T 5: 148,076,903 E169* probably null Het
Muc5b A G 7: 141,862,028 T2904A possibly damaging Het
Noxa1 C T 2: 25,092,541 probably null Het
Ogfod3 G A 11: 121,204,550 R5W probably damaging Het
Olfr1312 T A 2: 112,042,637 I132F probably damaging Het
Olfr1504 A G 19: 13,887,389 S274P probably damaging Het
Pgm3 C A 9: 86,564,775 R230L probably benign Het
Plpbp A G 8: 27,046,041 I121V unknown Het
Prl8a9 T C 13: 27,559,372 D150G probably benign Het
Psapl1 A G 5: 36,205,575 N504D probably benign Het
Ptchd4 A C 17: 42,503,175 N656H probably benign Het
Ptprs A T 17: 56,434,532 Y577* probably null Het
Rasgef1c A G 11: 49,967,401 Y263C probably damaging Het
Rinl A G 7: 28,790,589 probably null Het
Scd4 T C 19: 44,337,506 F100L probably benign Het
Scgb2b20 T G 7: 33,364,544 R100S probably benign Het
Scn8a C T 15: 101,029,837 A1399V probably benign Het
Slc22a7 A G 17: 46,436,830 V267A probably benign Het
Slc7a11 T C 3: 50,417,991 E263G possibly damaging Het
Slmap A G 14: 26,422,548 L728P probably damaging Het
Smarcb1 A T 10: 75,910,152 probably null Het
Sspn T C 6: 145,955,635 V80A possibly damaging Het
Terb1 T C 8: 104,468,767 T581A probably benign Het
Themis A G 10: 28,797,506 *596W probably null Het
Trac T C 14: 54,223,100 probably benign Het
Trim37 T C 11: 87,218,267 F940S possibly damaging Het
Trpa1 T C 1: 14,904,266 T231A probably benign Het
Ttn T C 2: 76,750,185 I23455V probably benign Het
Wap G T 11: 6,636,724 T125K probably benign Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Zfp85 T C 13: 67,748,774 D393G possibly damaging Het
Other mutations in Olfr855
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Olfr855 APN 9 19585320 missense possibly damaging 0.74
IGL01405:Olfr855 APN 9 19585205 missense probably benign 0.23
IGL01775:Olfr855 APN 9 19584705 missense probably benign 0.04
IGL01920:Olfr855 APN 9 19585022 missense probably benign 0.01
R0501:Olfr855 UTSW 9 19584618 missense probably damaging 1.00
R0600:Olfr855 UTSW 9 19585304 missense possibly damaging 0.47
R0667:Olfr855 UTSW 9 19585447 missense probably benign
R1769:Olfr855 UTSW 9 19585386 missense probably damaging 0.98
R3117:Olfr855 UTSW 9 19584941 missense probably damaging 0.99
R4002:Olfr855 UTSW 9 19584714 missense probably damaging 1.00
R4003:Olfr855 UTSW 9 19584714 missense probably damaging 1.00
R4043:Olfr855 UTSW 9 19584995 missense probably benign 0.16
R4243:Olfr855 UTSW 9 19584558 missense probably damaging 1.00
R4672:Olfr855 UTSW 9 19585430 missense possibly damaging 0.74
R4673:Olfr855 UTSW 9 19585430 missense possibly damaging 0.74
R4959:Olfr855 UTSW 9 19585208 missense probably benign
R4973:Olfr855 UTSW 9 19585208 missense probably benign
R5223:Olfr855 UTSW 9 19585026 missense probably benign 0.16
R5681:Olfr855 UTSW 9 19584899 missense probably damaging 1.00
R6005:Olfr855 UTSW 9 19584885 missense probably benign 0.45
R6017:Olfr855 UTSW 9 19585434 missense probably benign 0.00
R6145:Olfr855 UTSW 9 19584888 missense probably benign 0.02
R6615:Olfr855 UTSW 9 19584989 missense probably benign 0.05
R6771:Olfr855 UTSW 9 19585379 missense probably benign 0.16
R6969:Olfr855 UTSW 9 19584590 missense possibly damaging 0.77
R7239:Olfr855 UTSW 9 19585191 missense probably damaging 1.00
R7313:Olfr855 UTSW 9 19584642 missense probably damaging 1.00
R7361:Olfr855 UTSW 9 19584560 missense probably benign 0.00
R8470:Olfr855 UTSW 9 19584969 missense probably damaging 0.99
R9155:Olfr855 UTSW 9 19585083 missense probably benign 0.00
R9187:Olfr855 UTSW 9 19584654 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGACAAGAAACATGGAGCCC -3'
(R):5'- CTTAATGGGTGACAAATAGCTGCATAG -3'

Sequencing Primer
(F):5'- TGGAGCCCCAAAACAAAACG -3'
(R):5'- TGCATAGCGATCATAGGCC -3'
Posted On 2020-06-30