Incidental Mutation 'R8112:Gen1'
ID630947
Institutional Source Beutler Lab
Gene Symbol Gen1
Ensembl Gene ENSMUSG00000051235
Gene NameGEN1, Holliday junction 5' flap endonuclease
Synonyms5830483C08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R8112 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location11238920-11265801 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 11254373 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 230 (K230*)
Ref Sequence ENSEMBL: ENSMUSP00000132098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166117] [ENSMUST00000218259] [ENSMUST00000218487] [ENSMUST00000218547]
Predicted Effect probably null
Transcript: ENSMUST00000166117
AA Change: K230*
SMART Domains Protein: ENSMUSP00000132098
Gene: ENSMUSG00000051235
AA Change: K230*

DomainStartEndE-ValueType
XPGN 1 96 9.13e-22 SMART
XPGI 122 193 5.32e-23 SMART
HhH2 195 229 2.87e-5 SMART
low complexity region 704 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218259
Predicted Effect probably null
Transcript: ENSMUST00000218487
AA Change: K165*
Predicted Effect probably null
Transcript: ENSMUST00000218547
AA Change: K165*
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rad2/xeroderma pigmentosum group G nuclease family, whose members are characterized by N-terminal and internal xeroderma pigmentosum group G nuclease domains followed by helix-hairpin-helix domains and disordered C-terminal domains. The protein encoded by this gene is involved in resolution of Holliday junctions, which are intermediate four-way structures that covalently link DNA during homologous recombination and double-strand break repair. The protein resolves Holliday junctions by creating dual incisions across the junction to produce nicked duplex products that can be ligated. In addition, this protein has been found to localize to centrosomes where it has been implicated in regulation of centrosome integrity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,314,624 V3002A probably benign Het
Aifm3 T C 16: 17,502,940 V422A probably damaging Het
Alx3 G T 3: 107,604,984 E313* probably null Het
Arfgef3 A G 10: 18,652,631 V336A possibly damaging Het
Art5 A T 7: 102,098,011 V187E probably benign Het
Atxn1 A G 13: 45,567,957 V154A probably benign Het
B3galt1 A G 2: 68,118,358 D139G probably damaging Het
BC005561 T C 5: 104,521,635 F1341S probably benign Het
Cbx5 A G 15: 103,199,744 V158A probably benign Het
Cdca7l T C 12: 117,877,044 probably null Het
Cecr2 T C 6: 120,762,214 S1301P probably benign Het
Chmp3 T A 6: 71,561,028 S80T probably benign Het
Cyp2g1 T A 7: 26,819,461 D427E probably benign Het
Depdc5 G A 5: 32,968,706 V1199I possibly damaging Het
Ehmt1 G T 2: 24,863,384 L335M probably damaging Het
Elfn2 A G 15: 78,673,435 V304A probably damaging Het
Emc1 C T 4: 139,367,187 R684W probably benign Het
Eme2 A T 17: 24,894,835 V72E probably damaging Het
Fam208b A T 13: 3,569,516 D2238E probably damaging Het
Gfap T A 11: 102,897,102 I6F probably benign Het
Gm11639 T C 11: 104,950,200 V3643A unknown Het
Grid2 T C 6: 63,908,907 S96P probably damaging Het
H2-M2 A G 17: 37,483,492 L13P unknown Het
Hps4 T G 5: 112,370,111 C323W probably benign Het
Ing3 A G 6: 21,952,182 K52E probably damaging Het
Ippk C T 13: 49,446,342 P226S Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Krt4 T A 15: 101,920,289 N380I probably damaging Het
Lrp1 A T 10: 127,605,846 C174S probably damaging Het
Lrrc8e T C 8: 4,235,575 I600T probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Mindy1 T C 3: 95,294,811 L333P probably damaging Het
Mrgprb1 A G 7: 48,447,934 S77P probably damaging Het
Mtus2 G T 5: 148,076,903 E169* probably null Het
Muc5b A G 7: 141,862,028 T2904A possibly damaging Het
Noxa1 C T 2: 25,092,541 probably null Het
Ogfod3 G A 11: 121,204,550 R5W probably damaging Het
Olfr1312 T A 2: 112,042,637 I132F probably damaging Het
Olfr1504 A G 19: 13,887,389 S274P probably damaging Het
Olfr855 T A 9: 19,584,724 F62L probably benign Het
Pgm3 C A 9: 86,564,775 R230L probably benign Het
Plpbp A G 8: 27,046,041 I121V unknown Het
Prl8a9 T C 13: 27,559,372 D150G probably benign Het
Psapl1 A G 5: 36,205,575 N504D probably benign Het
Ptchd4 A C 17: 42,503,175 N656H probably benign Het
Ptprs A T 17: 56,434,532 Y577* probably null Het
Rasgef1c A G 11: 49,967,401 Y263C probably damaging Het
Rinl A G 7: 28,790,589 probably null Het
Scd4 T C 19: 44,337,506 F100L probably benign Het
Scgb2b20 T G 7: 33,364,544 R100S probably benign Het
Scn8a C T 15: 101,029,837 A1399V probably benign Het
Slc22a7 A G 17: 46,436,830 V267A probably benign Het
Slc7a11 T C 3: 50,417,991 E263G possibly damaging Het
Slmap A G 14: 26,422,548 L728P probably damaging Het
Smarcb1 A T 10: 75,910,152 probably null Het
Sspn T C 6: 145,955,635 V80A possibly damaging Het
Terb1 T C 8: 104,468,767 T581A probably benign Het
Themis A G 10: 28,797,506 *596W probably null Het
Trac T C 14: 54,223,100 probably benign Het
Trim37 T C 11: 87,218,267 F940S possibly damaging Het
Trpa1 T C 1: 14,904,266 T231A probably benign Het
Ttn T C 2: 76,750,185 I23455V probably benign Het
Wap G T 11: 6,636,724 T125K probably benign Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Zfp85 T C 13: 67,748,774 D393G possibly damaging Het
Other mutations in Gen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Gen1 APN 12 11261067 missense probably damaging 1.00
IGL01308:Gen1 APN 12 11256870 missense probably damaging 1.00
IGL01384:Gen1 APN 12 11255241 missense probably benign 0.00
IGL01766:Gen1 APN 12 11256894 missense probably damaging 1.00
IGL02132:Gen1 APN 12 11241866 missense probably benign 0.37
IGL02191:Gen1 APN 12 11242296 missense probably benign 0.18
IGL02452:Gen1 APN 12 11242575 missense probably benign 0.02
IGL02479:Gen1 APN 12 11241935 missense probably benign 0.01
IGL02690:Gen1 APN 12 11241575 missense probably damaging 0.96
IGL03095:Gen1 APN 12 11248264 missense probably benign 0.38
PIT4520001:Gen1 UTSW 12 11241508 missense probably benign 0.12
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0355:Gen1 UTSW 12 11248354 splice site probably benign
R0680:Gen1 UTSW 12 11241869 missense probably benign 0.06
R0891:Gen1 UTSW 12 11248354 splice site probably benign
R1192:Gen1 UTSW 12 11255218 missense probably damaging 0.97
R1353:Gen1 UTSW 12 11243219 missense probably benign 0.00
R1833:Gen1 UTSW 12 11248351 splice site probably benign
R1898:Gen1 UTSW 12 11241608 missense probably benign 0.10
R2138:Gen1 UTSW 12 11241621 missense probably damaging 1.00
R2185:Gen1 UTSW 12 11261040 missense probably null 0.95
R2409:Gen1 UTSW 12 11249164 missense possibly damaging 0.75
R2876:Gen1 UTSW 12 11242068 missense probably benign 0.13
R3815:Gen1 UTSW 12 11252033 missense possibly damaging 0.84
R4402:Gen1 UTSW 12 11242362 missense possibly damaging 0.71
R4572:Gen1 UTSW 12 11242418 missense probably damaging 0.99
R4900:Gen1 UTSW 12 11241560 missense probably benign 0.00
R5091:Gen1 UTSW 12 11246346 missense probably damaging 0.97
R5952:Gen1 UTSW 12 11260896 missense probably damaging 0.96
R6785:Gen1 UTSW 12 11262530 missense possibly damaging 0.89
R6869:Gen1 UTSW 12 11241441 missense probably benign 0.02
R7057:Gen1 UTSW 12 11242418 missense probably benign 0.21
R7155:Gen1 UTSW 12 11241832 missense probably benign 0.25
R7260:Gen1 UTSW 12 11256848 missense probably damaging 0.99
R7316:Gen1 UTSW 12 11241469 missense probably benign
R7512:Gen1 UTSW 12 11260976 missense possibly damaging 0.79
R7692:Gen1 UTSW 12 11242166 missense probably benign 0.22
R7800:Gen1 UTSW 12 11241862 missense probably benign 0.00
R8061:Gen1 UTSW 12 11261076 splice site probably benign
R8147:Gen1 UTSW 12 11255050 intron probably null
R8152:Gen1 UTSW 12 11243265 missense probably damaging 0.99
R8153:Gen1 UTSW 12 11260947 missense probably damaging 1.00
R8161:Gen1 UTSW 12 11241464 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GATAGGCTTGCCTTCGTACTG -3'
(R):5'- TGCCTGTCATCATCGTGTTAG -3'

Sequencing Primer
(F):5'- GTACTGTGTGTAGTGAAGCAATAAAC -3'
(R):5'- GTTCGTACAGTGATAGGAATTACAG -3'
Posted On2020-06-30