Incidental Mutation 'R8112:H2-M2'
ID 630964
Institutional Source Beutler Lab
Gene Symbol H2-M2
Ensembl Gene ENSMUSG00000016283
Gene Name histocompatibility 2, M region locus 2
Synonyms Thy19.4, H-2M2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8112 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 37480851-37483552 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 37483492 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 13 (L13P)
Ref Sequence ENSEMBL: ENSMUSP00000131297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016427] [ENSMUST00000171139]
AlphaFold Q6W9L1
Predicted Effect unknown
Transcript: ENSMUST00000016427
AA Change: L13P
SMART Domains Protein: ENSMUSP00000016427
Gene: ENSMUSG00000016283
AA Change: L13P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:MHC_I 29 207 1.6e-77 PFAM
IGc1 226 297 2.11e-20 SMART
Predicted Effect unknown
Transcript: ENSMUST00000171139
AA Change: L13P
SMART Domains Protein: ENSMUSP00000131297
Gene: ENSMUSG00000016283
AA Change: L13P

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:MHC_I 29 207 7.1e-76 PFAM
IGc1 226 297 2.11e-20 SMART
transmembrane domain 308 330 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,314,624 V3002A probably benign Het
Aifm3 T C 16: 17,502,940 V422A probably damaging Het
Alx3 G T 3: 107,604,984 E313* probably null Het
Arfgef3 A G 10: 18,652,631 V336A possibly damaging Het
Art5 A T 7: 102,098,011 V187E probably benign Het
Atxn1 A G 13: 45,567,957 V154A probably benign Het
B3galt1 A G 2: 68,118,358 D139G probably damaging Het
BC005561 T C 5: 104,521,635 F1341S probably benign Het
Cbx5 A G 15: 103,199,744 V158A probably benign Het
Cdca7l T C 12: 117,877,044 probably null Het
Cecr2 T C 6: 120,762,214 S1301P probably benign Het
Chmp3 T A 6: 71,561,028 S80T probably benign Het
Cyp2g1 T A 7: 26,819,461 D427E probably benign Het
Depdc5 G A 5: 32,968,706 V1199I possibly damaging Het
Ehmt1 G T 2: 24,863,384 L335M probably damaging Het
Elfn2 A G 15: 78,673,435 V304A probably damaging Het
Emc1 C T 4: 139,367,187 R684W probably benign Het
Eme2 A T 17: 24,894,835 V72E probably damaging Het
Fam208b A T 13: 3,569,516 D2238E probably damaging Het
Gen1 T A 12: 11,254,373 K230* probably null Het
Gfap T A 11: 102,897,102 I6F probably benign Het
Gm11639 T C 11: 104,950,200 V3643A unknown Het
Grid2 T C 6: 63,908,907 S96P probably damaging Het
Hps4 T G 5: 112,370,111 C323W probably benign Het
Ing3 A G 6: 21,952,182 K52E probably damaging Het
Ippk C T 13: 49,446,342 P226S Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Krt4 T A 15: 101,920,289 N380I probably damaging Het
Lrp1 A T 10: 127,605,846 C174S probably damaging Het
Lrrc8e T C 8: 4,235,575 I600T probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Mindy1 T C 3: 95,294,811 L333P probably damaging Het
Mrgprb1 A G 7: 48,447,934 S77P probably damaging Het
Mtus2 G T 5: 148,076,903 E169* probably null Het
Muc5b A G 7: 141,862,028 T2904A possibly damaging Het
Noxa1 C T 2: 25,092,541 probably null Het
Ogfod3 G A 11: 121,204,550 R5W probably damaging Het
Olfr1312 T A 2: 112,042,637 I132F probably damaging Het
Olfr1504 A G 19: 13,887,389 S274P probably damaging Het
Olfr855 T A 9: 19,584,724 F62L probably benign Het
Pgm3 C A 9: 86,564,775 R230L probably benign Het
Plpbp A G 8: 27,046,041 I121V unknown Het
Prl8a9 T C 13: 27,559,372 D150G probably benign Het
Psapl1 A G 5: 36,205,575 N504D probably benign Het
Ptchd4 A C 17: 42,503,175 N656H probably benign Het
Ptprs A T 17: 56,434,532 Y577* probably null Het
Rasgef1c A G 11: 49,967,401 Y263C probably damaging Het
Rinl A G 7: 28,790,589 probably null Het
Scd4 T C 19: 44,337,506 F100L probably benign Het
Scgb2b20 T G 7: 33,364,544 R100S probably benign Het
Scn8a C T 15: 101,029,837 A1399V probably benign Het
Slc22a7 A G 17: 46,436,830 V267A probably benign Het
Slc7a11 T C 3: 50,417,991 E263G possibly damaging Het
Slmap A G 14: 26,422,548 L728P probably damaging Het
Smarcb1 A T 10: 75,910,152 probably null Het
Sspn T C 6: 145,955,635 V80A possibly damaging Het
Terb1 T C 8: 104,468,767 T581A probably benign Het
Themis A G 10: 28,797,506 *596W probably null Het
Trac T C 14: 54,223,100 probably benign Het
Trim37 T C 11: 87,218,267 F940S possibly damaging Het
Trpa1 T C 1: 14,904,266 T231A probably benign Het
Ttn T C 2: 76,750,185 I23455V probably benign Het
Wap G T 11: 6,636,724 T125K probably benign Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Zfp85 T C 13: 67,748,774 D393G possibly damaging Het
Other mutations in H2-M2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01683:H2-M2 APN 17 37481515 missense possibly damaging 0.95
Lock UTSW 17 37481508 missense probably damaging 1.00
Nokia UTSW 17 37481306 missense possibly damaging 0.59
R0799:H2-M2 UTSW 17 37482749 missense probably damaging 1.00
R0981:H2-M2 UTSW 17 37482630 missense probably benign 0.02
R1925:H2-M2 UTSW 17 37482500 missense probably damaging 0.98
R2959:H2-M2 UTSW 17 37483454 missense probably benign 0.20
R3968:H2-M2 UTSW 17 37481306 missense possibly damaging 0.59
R4063:H2-M2 UTSW 17 37481508 missense probably damaging 1.00
R4735:H2-M2 UTSW 17 37483244 missense possibly damaging 0.91
R5806:H2-M2 UTSW 17 37481726 missense probably damaging 1.00
R6410:H2-M2 UTSW 17 37483213 missense probably damaging 1.00
R7432:H2-M2 UTSW 17 37481470 critical splice donor site probably null
R7456:H2-M2 UTSW 17 37481661 missense possibly damaging 0.60
R7535:H2-M2 UTSW 17 37482637 missense probably benign 0.07
R7680:H2-M2 UTSW 17 37483025 missense possibly damaging 0.56
R8910:H2-M2 UTSW 17 37481522 missense probably damaging 1.00
R9034:H2-M2 UTSW 17 37481285 missense probably benign 0.05
R9193:H2-M2 UTSW 17 37482537 missense probably benign 0.00
R9420:H2-M2 UTSW 17 37481324 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CTGATGTTTGGCTTGAACCTTC -3'
(R):5'- TTCTGCATGGACACTGATGAC -3'

Sequencing Primer
(F):5'- TCCAGGGCAGGTGGTAG -3'
(R):5'- ATGGACACTGATGACTATGCTCC -3'
Posted On 2020-06-30