Incidental Mutation 'R8112:Olfr1504'
ID630969
Institutional Source Beutler Lab
Gene Symbol Olfr1504
Ensembl Gene ENSMUSG00000059105
Gene Nameolfactory receptor 1504
SynonymsMOR212-2, GA_x6K02T2RE5P-4223635-4222688
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R8112 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location13886920-13897928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13887389 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 274 (S274P)
Ref Sequence ENSEMBL: ENSMUSP00000146610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078282] [ENSMUST00000209192]
Predicted Effect probably damaging
Transcript: ENSMUST00000078282
AA Change: S274P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077400
Gene: ENSMUSG00000059105
AA Change: S274P

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 4.3e-46 PFAM
Pfam:7tm_1 40 313 1.5e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209192
AA Change: S274P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,314,624 V3002A probably benign Het
Aifm3 T C 16: 17,502,940 V422A probably damaging Het
Alx3 G T 3: 107,604,984 E313* probably null Het
Arfgef3 A G 10: 18,652,631 V336A possibly damaging Het
Art5 A T 7: 102,098,011 V187E probably benign Het
Atxn1 A G 13: 45,567,957 V154A probably benign Het
B3galt1 A G 2: 68,118,358 D139G probably damaging Het
BC005561 T C 5: 104,521,635 F1341S probably benign Het
Cbx5 A G 15: 103,199,744 V158A probably benign Het
Cdca7l T C 12: 117,877,044 probably null Het
Cecr2 T C 6: 120,762,214 S1301P probably benign Het
Chmp3 T A 6: 71,561,028 S80T probably benign Het
Cyp2g1 T A 7: 26,819,461 D427E probably benign Het
Depdc5 G A 5: 32,968,706 V1199I possibly damaging Het
Ehmt1 G T 2: 24,863,384 L335M probably damaging Het
Elfn2 A G 15: 78,673,435 V304A probably damaging Het
Emc1 C T 4: 139,367,187 R684W probably benign Het
Eme2 A T 17: 24,894,835 V72E probably damaging Het
Fam208b A T 13: 3,569,516 D2238E probably damaging Het
Gen1 T A 12: 11,254,373 K230* probably null Het
Gfap T A 11: 102,897,102 I6F probably benign Het
Gm11639 T C 11: 104,950,200 V3643A unknown Het
Grid2 T C 6: 63,908,907 S96P probably damaging Het
H2-M2 A G 17: 37,483,492 L13P unknown Het
Hps4 T G 5: 112,370,111 C323W probably benign Het
Ing3 A G 6: 21,952,182 K52E probably damaging Het
Ippk C T 13: 49,446,342 P226S Het
Klhl3 C T 13: 58,013,863 V473M possibly damaging Het
Krt4 T A 15: 101,920,289 N380I probably damaging Het
Lrp1 A T 10: 127,605,846 C174S probably damaging Het
Lrrc8e T C 8: 4,235,575 I600T probably benign Het
Malt1 T C 18: 65,449,609 probably null Het
Mindy1 T C 3: 95,294,811 L333P probably damaging Het
Mrgprb1 A G 7: 48,447,934 S77P probably damaging Het
Mtus2 G T 5: 148,076,903 E169* probably null Het
Muc5b A G 7: 141,862,028 T2904A possibly damaging Het
Noxa1 C T 2: 25,092,541 probably null Het
Ogfod3 G A 11: 121,204,550 R5W probably damaging Het
Olfr1312 T A 2: 112,042,637 I132F probably damaging Het
Olfr855 T A 9: 19,584,724 F62L probably benign Het
Pgm3 C A 9: 86,564,775 R230L probably benign Het
Plpbp A G 8: 27,046,041 I121V unknown Het
Prl8a9 T C 13: 27,559,372 D150G probably benign Het
Psapl1 A G 5: 36,205,575 N504D probably benign Het
Ptchd4 A C 17: 42,503,175 N656H probably benign Het
Ptprs A T 17: 56,434,532 Y577* probably null Het
Rasgef1c A G 11: 49,967,401 Y263C probably damaging Het
Rinl A G 7: 28,790,589 probably null Het
Scd4 T C 19: 44,337,506 F100L probably benign Het
Scgb2b20 T G 7: 33,364,544 R100S probably benign Het
Scn8a C T 15: 101,029,837 A1399V probably benign Het
Slc22a7 A G 17: 46,436,830 V267A probably benign Het
Slc7a11 T C 3: 50,417,991 E263G possibly damaging Het
Slmap A G 14: 26,422,548 L728P probably damaging Het
Smarcb1 A T 10: 75,910,152 probably null Het
Sspn T C 6: 145,955,635 V80A possibly damaging Het
Terb1 T C 8: 104,468,767 T581A probably benign Het
Themis A G 10: 28,797,506 *596W probably null Het
Trac T C 14: 54,223,100 probably benign Het
Trim37 T C 11: 87,218,267 F940S possibly damaging Het
Trpa1 T C 1: 14,904,266 T231A probably benign Het
Ttn T C 2: 76,750,185 I23455V probably benign Het
Wap G T 11: 6,636,724 T125K probably benign Het
Wdfy4 G A 14: 33,104,115 P1193L Het
Zfp85 T C 13: 67,748,774 D393G possibly damaging Het
Other mutations in Olfr1504
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Olfr1504 APN 19 13887581 missense probably benign
IGL00885:Olfr1504 APN 19 13888168 missense probably benign 0.17
IGL01084:Olfr1504 APN 19 13887502 missense probably damaging 1.00
IGL01522:Olfr1504 APN 19 13887358 nonsense probably null
IGL01727:Olfr1504 APN 19 13887878 missense probably damaging 0.98
IGL02440:Olfr1504 APN 19 13887859 missense probably damaging 1.00
IGL03342:Olfr1504 APN 19 13887437 missense probably damaging 1.00
R0531:Olfr1504 UTSW 19 13887752 missense possibly damaging 0.62
R0577:Olfr1504 UTSW 19 13887803 missense probably damaging 1.00
R1028:Olfr1504 UTSW 19 13887795 missense probably damaging 0.97
R1674:Olfr1504 UTSW 19 13887590 missense probably benign 0.01
R3906:Olfr1504 UTSW 19 13887706 missense probably damaging 1.00
R4598:Olfr1504 UTSW 19 13888017 missense probably damaging 1.00
R4658:Olfr1504 UTSW 19 13887548 missense probably benign 0.19
R4676:Olfr1504 UTSW 19 13887401 missense probably damaging 1.00
R5919:Olfr1504 UTSW 19 13887845 missense probably damaging 1.00
R5943:Olfr1504 UTSW 19 13887752 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GTGCAATTCTGAGAGCAAAGTC -3'
(R):5'- AGCTTGCCTGTAGTGAGACC -3'

Sequencing Primer
(F):5'- TATTAAGAAGATAAAGCAAAGGCCC -3'
(R):5'- CTTGCCTGTAGTGAGACCAAGTTAC -3'
Posted On2020-06-30