Incidental Mutation 'R8113:Kcnt1'
ID 630976
Institutional Source Beutler Lab
Gene Symbol Kcnt1
Ensembl Gene ENSMUSG00000058740
Gene Name potassium channel, subfamily T, member 1
Synonyms C030030G16Rik, Slack, slo2
MMRRC Submission 067542-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.194) question?
Stock # R8113 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 25753807-25808285 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 25791223 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 522 (E522G)
Ref Sequence ENSEMBL: ENSMUSP00000039058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037580] [ENSMUST00000114172] [ENSMUST00000114176] [ENSMUST00000128502] [ENSMUST00000153001] [ENSMUST00000171268] [ENSMUST00000197917] [ENSMUST00000198204] [ENSMUST00000200434]
AlphaFold Q6ZPR4
Predicted Effect possibly damaging
Transcript: ENSMUST00000037580
AA Change: E522G

PolyPhen 2 Score 0.671 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000039058
Gene: ENSMUSG00000058740
AA Change: E522G

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 252 335 1.3e-12 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 477 579 5.8e-32 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1212 1229 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114172
AA Change: E508G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109809
Gene: ENSMUSG00000058740
AA Change: E508G

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114176
AA Change: E522G

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109813
Gene: ENSMUSG00000058740
AA Change: E522G

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.1e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.2e-38 PFAM
PDB:3U6N|H 794 983 6e-6 PDB
low complexity region 1059 1076 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128502
Predicted Effect probably benign
Transcript: ENSMUST00000153001
SMART Domains Protein: ENSMUSP00000142532
Gene: ENSMUSG00000058740

DomainStartEndE-ValueType
PDB:4HPF|B 79 285 6e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000171268
AA Change: E502G

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132212
Gene: ENSMUSG00000058740
AA Change: E502G

DomainStartEndE-ValueType
transmembrane domain 78 97 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:Ion_trans_2 235 315 5.1e-13 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Pfam:BK_channel_a 455 560 3.2e-38 PFAM
PDB:3U6N|H 774 963 7e-6 PDB
low complexity region 1039 1056 N/A INTRINSIC
low complexity region 1192 1209 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197917
AA Change: E522G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143106
Gene: ENSMUSG00000058740
AA Change: E522G

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
transmembrane domain 98 117 N/A INTRINSIC
transmembrane domain 157 179 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Pfam:Ion_trans_2 255 335 5.2e-13 PFAM
transmembrane domain 355 377 N/A INTRINSIC
Pfam:BK_channel_a 475 580 3.3e-38 PFAM
PDB:3U6N|H 792 981 7e-6 PDB
low complexity region 1057 1074 N/A INTRINSIC
low complexity region 1210 1227 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000198204
AA Change: E488G

PolyPhen 2 Score 0.476 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142870
Gene: ENSMUSG00000058740
AA Change: E488G

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.2e-35 PFAM
PDB:3U6N|H 760 949 6e-6 PDB
low complexity region 1025 1042 N/A INTRINSIC
low complexity region 1157 1174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200434
AA Change: E488G

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000143482
Gene: ENSMUSG00000058740
AA Change: E488G

DomainStartEndE-ValueType
transmembrane domain 64 83 N/A INTRINSIC
transmembrane domain 123 145 N/A INTRINSIC
transmembrane domain 154 176 N/A INTRINSIC
Pfam:Ion_trans_2 221 301 5.1e-11 PFAM
transmembrane domain 321 343 N/A INTRINSIC
Pfam:BK_channel_a 441 546 1.3e-35 PFAM
PDB:3U6N|H 758 947 6e-6 PDB
low complexity region 1023 1040 N/A INTRINSIC
low complexity region 1176 1193 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 96% (72/75)
MGI Phenotype FUNCTION: This gene encodes a member of the Slo potassium channel family that has shown to be activated by both sodium and chloride ions. This channel represents the largest potassium channel subunit yet identified. This channel may be important in development and pain signaling. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired action potential firing in sensory neurons and increased mechanical hypersensitivity in neuropathic pain models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 T C 8: 89,048,431 (GRCm39) S625P probably damaging Het
Agpat1 T C 17: 34,830,586 (GRCm39) V170A probably damaging Het
Alg9 C T 9: 50,720,080 (GRCm39) Q519* probably null Het
Apol8 C T 15: 77,634,336 (GRCm39) R80H probably benign Het
Arhgap25 G T 6: 87,465,287 (GRCm39) S118* probably null Het
Arhgap30 T A 1: 171,225,086 (GRCm39) Y47* probably null Het
Arhgap42 C T 9: 9,011,434 (GRCm39) D451N probably damaging Het
Cabp2 T A 19: 4,135,582 (GRCm39) F91I probably damaging Het
Ccdc30 T C 4: 119,230,943 (GRCm39) E108G probably benign Het
Cfap99 T C 5: 34,458,763 (GRCm39) S53P probably damaging Het
Clec5a C T 6: 40,556,361 (GRCm39) R135H possibly damaging Het
Cops8 T G 1: 90,531,325 (GRCm39) D18E probably benign Het
Cped1 A T 6: 22,233,480 (GRCm39) M779L possibly damaging Het
Cyp4x1 G A 4: 114,967,263 (GRCm39) H438Y probably damaging Het
Disc1 A T 8: 125,815,014 (GRCm39) T293S probably benign Het
Ercc1 T C 7: 19,084,102 (GRCm39) L113S probably damaging Het
Ermp1 G T 19: 29,593,196 (GRCm39) N765K probably benign Het
Fam83c A G 2: 155,676,740 (GRCm39) I10T probably benign Het
Farp1 T C 14: 121,513,008 (GRCm39) V788A probably benign Het
Fbn1 C G 2: 125,319,489 (GRCm39) G92R probably damaging Het
Fsd1 T A 17: 56,302,881 (GRCm39) M328K probably benign Het
Fzd3 C A 14: 65,440,262 (GRCm39) S636I probably benign Het
Gapvd1 A G 2: 34,594,330 (GRCm39) S886P probably damaging Het
Gatad2b T A 3: 90,249,029 (GRCm39) D22E probably benign Het
Gm7168 A T 17: 14,169,238 (GRCm39) K202* probably null Het
Gmps T C 3: 63,887,690 (GRCm39) I54T probably damaging Het
Gp6 A G 7: 4,397,114 (GRCm39) I107T probably benign Het
Gpat2 T C 2: 127,273,267 (GRCm39) V217A possibly damaging Het
Hdlbp T A 1: 93,344,917 (GRCm39) I863F probably damaging Het
Hmcn1 A C 1: 150,624,841 (GRCm39) I1021M possibly damaging Het
Igkv6-14 C T 6: 70,412,087 (GRCm39) A66T probably benign Het
Ippk C T 13: 49,599,818 (GRCm39) P226S Het
Iqch A G 9: 63,361,855 (GRCm39) I925T probably benign Het
Kremen2 C G 17: 23,962,776 (GRCm39) E103D probably damaging Het
Lig4 G T 8: 10,023,485 (GRCm39) N98K probably benign Het
Lrrc3b T G 14: 15,358,232 (GRCm38) I125L probably benign Het
Lrrc4 T C 6: 28,829,902 (GRCm39) D148G probably damaging Het
Lrsam1 A G 2: 32,837,901 (GRCm39) Y218H possibly damaging Het
Mmrn2 G A 14: 34,119,593 (GRCm39) V191I probably benign Het
Nadk T A 4: 155,655,127 (GRCm39) probably null Het
Napb C A 2: 148,551,351 (GRCm39) A61S possibly damaging Het
Ncan T A 8: 70,561,221 (GRCm39) D582V possibly damaging Het
Ncl T C 1: 86,284,364 (GRCm39) D244G possibly damaging Het
Nlrp14 A G 7: 106,791,715 (GRCm39) N800S possibly damaging Het
Nlrp9b C T 7: 19,753,260 (GRCm39) T55M probably benign Het
Nobox G A 6: 43,282,951 (GRCm39) T228I probably benign Het
Npffr1 C A 10: 61,449,750 (GRCm39) P8H possibly damaging Het
Nrg2 T C 18: 36,154,156 (GRCm39) Y587C probably damaging Het
Nsd1 T G 13: 55,393,434 (GRCm39) V448G probably benign Het
Or2w1 T A 13: 21,317,371 (GRCm39) V142D probably benign Het
Or5e1 G T 7: 108,354,438 (GRCm39) C125F probably damaging Het
Or8k41 T G 2: 86,313,412 (GRCm39) I225L probably damaging Het
Or9g20 A G 2: 85,630,011 (GRCm39) L201P probably damaging Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Ppp5c T C 7: 16,742,932 (GRCm39) T229A probably benign Het
Pramel51 T C 12: 88,143,850 (GRCm39) Y329C probably benign Het
Prr5 C T 15: 84,577,993 (GRCm39) R101C probably damaging Het
Psg22 T C 7: 18,456,987 (GRCm39) M290T probably benign Het
Pzp C T 6: 128,490,694 (GRCm39) probably null Het
Rapgef6 T C 11: 54,516,784 (GRCm39) V347A probably benign Het
Rttn A T 18: 89,029,040 (GRCm39) H586L probably damaging Het
Sema3f A T 9: 107,565,275 (GRCm39) I259K possibly damaging Het
Sgpp1 A T 12: 75,763,374 (GRCm39) L269Q probably damaging Het
Slc22a8 A C 19: 8,582,903 (GRCm39) I195L probably benign Het
Slc35a5 T C 16: 44,962,551 (GRCm39) T425A unknown Het
Spata31e1 G A 13: 49,939,548 (GRCm39) R721C probably benign Het
Stard13 G A 5: 150,986,970 (GRCm39) T180I probably damaging Het
Stard9 G A 2: 120,534,911 (GRCm39) G3723S probably benign Het
Svil A T 18: 5,062,385 (GRCm39) T902S probably damaging Het
Tnfaip8l3 T A 9: 53,934,421 (GRCm39) R185W probably damaging Het
Ttn A T 2: 76,590,393 (GRCm39) D21105E probably benign Het
Vmn2r109 T A 17: 20,774,729 (GRCm39) M209L probably benign Het
Vmn2r125 A G 4: 156,703,642 (GRCm39) H340R probably damaging Het
Zfp946 T C 17: 22,674,481 (GRCm39) C412R probably damaging Het
Other mutations in Kcnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Kcnt1 APN 2 25,782,419 (GRCm39) missense probably damaging 0.98
IGL01358:Kcnt1 APN 2 25,806,017 (GRCm39) missense probably damaging 1.00
IGL01593:Kcnt1 APN 2 25,788,766 (GRCm39) missense probably damaging 1.00
IGL01779:Kcnt1 APN 2 25,790,979 (GRCm39) missense probably damaging 1.00
IGL01800:Kcnt1 APN 2 25,778,137 (GRCm39) missense probably damaging 1.00
IGL01834:Kcnt1 APN 2 25,802,731 (GRCm39) critical splice donor site probably null
IGL02001:Kcnt1 APN 2 25,798,164 (GRCm39) missense probably damaging 1.00
IGL02061:Kcnt1 APN 2 25,790,494 (GRCm39) critical splice donor site probably null
IGL02121:Kcnt1 APN 2 25,791,877 (GRCm39) missense probably damaging 1.00
IGL02646:Kcnt1 APN 2 25,790,892 (GRCm39) splice site probably benign
IGL02683:Kcnt1 APN 2 25,790,937 (GRCm39) missense possibly damaging 0.85
IGL03028:Kcnt1 APN 2 25,799,215 (GRCm39) critical splice acceptor site probably null
IGL03139:Kcnt1 APN 2 25,784,480 (GRCm39) splice site probably benign
R0070:Kcnt1 UTSW 2 25,782,374 (GRCm39) missense probably benign 0.00
R0070:Kcnt1 UTSW 2 25,782,374 (GRCm39) missense probably benign 0.00
R0149:Kcnt1 UTSW 2 25,788,276 (GRCm39) splice site probably benign
R0294:Kcnt1 UTSW 2 25,778,122 (GRCm39) missense probably damaging 0.99
R0367:Kcnt1 UTSW 2 25,797,640 (GRCm39) missense probably damaging 1.00
R0481:Kcnt1 UTSW 2 25,782,508 (GRCm39) missense probably damaging 0.98
R0666:Kcnt1 UTSW 2 25,781,255 (GRCm39) splice site probably benign
R1364:Kcnt1 UTSW 2 25,798,106 (GRCm39) missense probably damaging 0.99
R1553:Kcnt1 UTSW 2 25,790,397 (GRCm39) missense probably damaging 1.00
R1916:Kcnt1 UTSW 2 25,790,481 (GRCm39) missense probably damaging 1.00
R1999:Kcnt1 UTSW 2 25,782,372 (GRCm39) missense probably benign
R2079:Kcnt1 UTSW 2 25,790,260 (GRCm39) missense possibly damaging 0.48
R2166:Kcnt1 UTSW 2 25,781,195 (GRCm39) splice site probably benign
R2295:Kcnt1 UTSW 2 25,790,933 (GRCm39) missense probably damaging 1.00
R3688:Kcnt1 UTSW 2 25,784,371 (GRCm39) missense probably damaging 1.00
R3820:Kcnt1 UTSW 2 25,790,904 (GRCm39) missense probably damaging 1.00
R3826:Kcnt1 UTSW 2 25,805,880 (GRCm39) critical splice donor site probably null
R3980:Kcnt1 UTSW 2 25,783,226 (GRCm39) missense possibly damaging 0.91
R4031:Kcnt1 UTSW 2 25,806,060 (GRCm39) missense possibly damaging 0.77
R4093:Kcnt1 UTSW 2 25,767,927 (GRCm39) missense probably damaging 0.99
R4361:Kcnt1 UTSW 2 25,768,044 (GRCm39) missense probably benign 0.03
R4367:Kcnt1 UTSW 2 25,797,638 (GRCm39) missense probably damaging 1.00
R4850:Kcnt1 UTSW 2 25,798,112 (GRCm39) missense probably damaging 1.00
R5005:Kcnt1 UTSW 2 25,791,358 (GRCm39) missense probably damaging 1.00
R5119:Kcnt1 UTSW 2 25,799,334 (GRCm39) intron probably benign
R5223:Kcnt1 UTSW 2 25,793,434 (GRCm39) missense probably benign
R5243:Kcnt1 UTSW 2 25,798,086 (GRCm39) missense probably damaging 1.00
R5323:Kcnt1 UTSW 2 25,799,289 (GRCm39) missense possibly damaging 0.59
R5665:Kcnt1 UTSW 2 25,791,921 (GRCm39) nonsense probably null
R5888:Kcnt1 UTSW 2 25,798,122 (GRCm39) missense probably damaging 1.00
R5906:Kcnt1 UTSW 2 25,788,413 (GRCm39) missense probably damaging 1.00
R5906:Kcnt1 UTSW 2 25,784,536 (GRCm39) intron probably benign
R5927:Kcnt1 UTSW 2 25,799,388 (GRCm39) intron probably benign
R6160:Kcnt1 UTSW 2 25,782,395 (GRCm39) missense probably damaging 0.96
R6161:Kcnt1 UTSW 2 25,793,397 (GRCm39) missense probably benign 0.00
R6179:Kcnt1 UTSW 2 25,783,192 (GRCm39) missense probably damaging 1.00
R6222:Kcnt1 UTSW 2 25,782,522 (GRCm39) missense probably damaging 1.00
R6268:Kcnt1 UTSW 2 25,793,609 (GRCm39) splice site probably null
R6336:Kcnt1 UTSW 2 25,778,767 (GRCm39) splice site probably null
R6395:Kcnt1 UTSW 2 25,799,251 (GRCm39) missense possibly damaging 0.81
R6564:Kcnt1 UTSW 2 25,801,063 (GRCm39) missense probably benign 0.09
R6944:Kcnt1 UTSW 2 25,767,840 (GRCm39) intron probably benign
R7236:Kcnt1 UTSW 2 25,799,951 (GRCm39) splice site probably null
R7308:Kcnt1 UTSW 2 25,790,475 (GRCm39) missense possibly damaging 0.74
R7346:Kcnt1 UTSW 2 25,753,855 (GRCm39) unclassified probably benign
R7419:Kcnt1 UTSW 2 25,806,011 (GRCm39) missense probably benign 0.11
R7461:Kcnt1 UTSW 2 25,791,358 (GRCm39) missense probably benign 0.01
R7470:Kcnt1 UTSW 2 25,799,845 (GRCm39) missense probably damaging 0.96
R7566:Kcnt1 UTSW 2 25,806,048 (GRCm39) missense probably benign 0.31
R7613:Kcnt1 UTSW 2 25,791,358 (GRCm39) missense probably benign 0.01
R7778:Kcnt1 UTSW 2 25,791,901 (GRCm39) missense probably benign 0.10
R8031:Kcnt1 UTSW 2 25,798,054 (GRCm39) splice site probably benign
R8088:Kcnt1 UTSW 2 25,784,326 (GRCm39) missense possibly damaging 0.63
R8378:Kcnt1 UTSW 2 25,797,283 (GRCm39) missense probably benign 0.03
R8954:Kcnt1 UTSW 2 25,784,338 (GRCm39) missense probably benign
R9231:Kcnt1 UTSW 2 25,801,074 (GRCm39) missense probably benign 0.00
R9445:Kcnt1 UTSW 2 25,767,959 (GRCm39) missense probably damaging 1.00
R9733:Kcnt1 UTSW 2 25,797,351 (GRCm39) missense probably benign 0.00
Z1176:Kcnt1 UTSW 2 25,796,808 (GRCm39) missense probably benign 0.07
Z1177:Kcnt1 UTSW 2 25,799,277 (GRCm39) nonsense probably null
Z1177:Kcnt1 UTSW 2 25,791,240 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGAGTGCAAGTACGCCATGC -3'
(R):5'- TCATAATGACCTGGCCCTGG -3'

Sequencing Primer
(F):5'- TGGCCCTGAACTGCATCTG -3'
(R):5'- ACGAGTAGCCCAGTGGTG -3'
Posted On 2020-06-30