Incidental Mutation 'R8113:Gp6'
ID631001
Institutional Source Beutler Lab
Gene Symbol Gp6
Ensembl Gene ENSMUSG00000078810
Gene Nameglycoprotein 6 (platelet)
SynonymsGpvi, 9830166G18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8113 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location4363965-4397744 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4394115 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 107 (I107T)
Ref Sequence ENSEMBL: ENSMUSP00000145740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108590] [ENSMUST00000206928]
Predicted Effect probably benign
Transcript: ENSMUST00000108590
AA Change: I107T

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104231
Gene: ENSMUSG00000078810
AA Change: I107T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 34 109 7.47e-3 SMART
IG 120 204 9.86e-3 SMART
transmembrane domain 266 285 N/A INTRINSIC
low complexity region 306 312 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206928
AA Change: I107T

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a platelet membrane glycoprotein of the immunoglobulin superfamily. The encoded protein is a receptor for collagen and plays a critical role in collagen-induced platelet aggregation and thrombus formation. The encoded protein forms a complex with the Fc receptor gamma-chain that initiates the platelet activation signaling cascade upon collagen binding. Mutations in this gene are a cause of platelet-type bleeding disorder-11 (BDPLT11). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous with disruptions in this gene display functional abnormalities in their platelets including failure of the platelets to aggregate and to become activated. The effects on blood clotting are minor however. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 T C 8: 88,321,803 S625P probably damaging Het
Agpat1 T C 17: 34,611,612 V170A probably damaging Het
Alg9 C T 9: 50,808,780 Q519* probably null Het
Apol8 C T 15: 77,750,136 R80H probably benign Het
Arhgap25 G T 6: 87,488,305 S118* probably null Het
Arhgap30 T A 1: 171,397,518 Y47* probably null Het
Arhgap42 C T 9: 9,011,433 D451N probably damaging Het
Cabp2 T A 19: 4,085,582 F91I probably damaging Het
Ccdc30 T C 4: 119,373,746 E108G probably benign Het
Cfap99 T C 5: 34,301,419 S53P probably damaging Het
Clec5a C T 6: 40,579,427 R135H possibly damaging Het
Cops8 T G 1: 90,603,603 D18E probably benign Het
Cped1 A T 6: 22,233,481 M779L possibly damaging Het
Cyp4x1 G A 4: 115,110,066 H438Y probably damaging Het
Disc1 A T 8: 125,088,275 T293S probably benign Het
Ercc1 T C 7: 19,350,177 L113S probably damaging Het
Ermp1 G T 19: 29,615,796 N765K probably benign Het
Fam83c A G 2: 155,834,820 I10T probably benign Het
Farp1 T C 14: 121,275,596 V788A probably benign Het
Fbn1 C G 2: 125,477,569 G92R probably damaging Het
Fsd1 T A 17: 55,995,881 M328K probably benign Het
Fzd3 C A 14: 65,202,813 S636I probably benign Het
Gapvd1 A G 2: 34,704,318 S886P probably damaging Het
Gatad2b T A 3: 90,341,722 D22E probably benign Het
Gm10436 T C 12: 88,177,080 Y329C probably benign Het
Gm30302 G A 13: 49,786,072 R721C probably benign Het
Gm7168 A T 17: 13,948,976 K202* probably null Het
Gmps T C 3: 63,980,269 I54T probably damaging Het
Gpat2 T C 2: 127,431,347 V217A possibly damaging Het
Hdlbp T A 1: 93,417,195 I863F probably damaging Het
Hmcn1 A C 1: 150,749,090 I1021M possibly damaging Het
Igkv6-14 C T 6: 70,435,103 A66T probably benign Het
Ippk C T 13: 49,446,342 P226S Het
Iqch A G 9: 63,454,573 I925T probably benign Het
Kcnt1 A G 2: 25,901,211 E522G possibly damaging Het
Kremen2 C G 17: 23,743,802 E103D probably damaging Het
Lig4 G T 8: 9,973,485 N98K probably benign Het
Lrrc3b T G 14: 15,358,232 I125L probably benign Het
Lrrc4 T C 6: 28,829,903 D148G probably damaging Het
Lrsam1 A G 2: 32,947,889 Y218H possibly damaging Het
Mmrn2 G A 14: 34,397,636 V191I probably benign Het
Napb C A 2: 148,709,431 A61S possibly damaging Het
Ncan T A 8: 70,108,571 D582V possibly damaging Het
Ncl T C 1: 86,356,642 D244G possibly damaging Het
Nlrp14 A G 7: 107,192,508 N800S possibly damaging Het
Nlrp9b C T 7: 20,019,335 T55M probably benign Het
Nobox G A 6: 43,306,017 T228I probably benign Het
Npffr1 C A 10: 61,613,971 P8H possibly damaging Het
Nrg2 T C 18: 36,021,103 Y587C probably damaging Het
Nsd1 T G 13: 55,245,621 V448G probably benign Het
Olfr1016 A G 2: 85,799,667 L201P probably damaging Het
Olfr228 T G 2: 86,483,068 I225L probably damaging Het
Olfr263 T A 13: 21,133,201 V142D probably benign Het
Olfr513 G T 7: 108,755,231 C125F probably damaging Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Ppp5c T C 7: 17,009,007 T229A probably benign Het
Prr5 C T 15: 84,693,792 R101C probably damaging Het
Psg22 T C 7: 18,723,062 M290T probably benign Het
Rapgef6 T C 11: 54,625,958 V347A probably benign Het
Rttn A T 18: 89,010,916 H586L probably damaging Het
Sema3f A T 9: 107,688,076 I259K possibly damaging Het
Sgpp1 A T 12: 75,716,600 L269Q probably damaging Het
Slc22a8 A C 19: 8,605,539 I195L probably benign Het
Slc35a5 T C 16: 45,142,188 T425A unknown Het
Stard13 G A 5: 151,063,505 T180I probably damaging Het
Stard9 G A 2: 120,704,430 G3723S probably benign Het
Svil A T 18: 5,062,385 T902S probably damaging Het
Tnfaip8l3 T A 9: 54,027,137 R185W probably damaging Het
Ttn A T 2: 76,760,049 D21105E probably benign Het
Vmn2r109 T A 17: 20,554,467 M209L probably benign Het
Vmn2r125 A G 4: 156,351,347 H340R probably damaging Het
Zfp946 T C 17: 22,455,500 C412R probably damaging Het
Other mutations in Gp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Gp6 APN 7 4394104 splice site probably benign
IGL02351:Gp6 APN 7 4394508 missense probably benign 0.03
IGL02358:Gp6 APN 7 4394508 missense probably benign 0.03
IGL02660:Gp6 APN 7 4384998 missense probably benign 0.01
IGL03081:Gp6 APN 7 4371648 missense probably benign 0.01
R0112:Gp6 UTSW 7 4370184 missense probably benign 0.08
R0112:Gp6 UTSW 7 4371627 missense probably benign 0.12
R0211:Gp6 UTSW 7 4373209 critical splice donor site probably null
R0356:Gp6 UTSW 7 4370142 splice site probably benign
R2006:Gp6 UTSW 7 4384989 missense probably benign 0.33
R2047:Gp6 UTSW 7 4373271 splice site probably benign
R5219:Gp6 UTSW 7 4368999 missense possibly damaging 0.70
R5571:Gp6 UTSW 7 4368900 missense probably damaging 1.00
R5639:Gp6 UTSW 7 4394131 missense probably damaging 1.00
R6224:Gp6 UTSW 7 4394212 missense probably benign 0.03
R6555:Gp6 UTSW 7 4384930 missense probably damaging 0.99
R7625:Gp6 UTSW 7 4370174 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GTTTACAGGCATGAAATTCTCCAAG -3'
(R):5'- TATTCTGAGGTGCCAGGGAC -3'

Sequencing Primer
(F):5'- GGCTGTTTTGAAGACACTAACCTC -3'
(R):5'- AGGGACCTCCAGATGTGG -3'
Posted On2020-06-30